Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19894
Trapped Gene
C8g (ENSMUSG00000015083)
Vector Insertion
Chr 2: 25355496 - 25355613
Public Clones not available
Private Clones OST377855 (lexicon) OST299445 (lexicon)
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000569246 (Chr2:25355614..25356026 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000569246 (Chr2:25355614..25356026 -)
Downstram Exon
ENSMUSE00000164534 (Chr2:25355359..25355495 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000164536 Chr2:25357048..25357083 No primer for this exon
upstream ENSMUSE00000569246 Chr2:25355614..25356026 No primer for this exon

*** Putative Vector Insertion (Chr 2: 25355496 - 25355613) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000164534 Chr2:25355359..25355495 No primer for this exon
downstream ENSMUSE00000164532 Chr2:25355109..25355179 No primer for this exon
downstream ENSMUSE00000164531 Chr2:25354918..25355025 No primer for this exon
downstream ENSMUSE00000164535 Chr2:25354534..25354635 No primer for this exon
downstream ENSMUSE00000164533 Chr2:25354425..25354463 No primer for this exon
downstream ENSMUSE00000605045 Chr2:25354176..25354343 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCAGGTCAATTTCAGTGCT Chr2:25355618..25355638 60.11 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCAGGTCAATTTCAGTGCT Chr2:25355618..25355638 60.11 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015083