Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19895
Trapped Gene
Ganab (ENSMUSG00000071650)
Vector Insertion
Chr 19: 8976859 - 8977011
Public Clones not available
Private Clones OST377831 (lexicon) OST196798 (lexicon) OST83823 (lexicon) OST32023 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000621613 (Chr19:8976754..8976858 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGGGATTACACTTGCTGTG Chr19:8976795..8976814 59.57 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000621613 (Chr19:8976754..8976858 +)
Downstram Exon
ENSMUSE00000621612 (Chr19:8977012..8977120 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGGGATTACACTTGCTGTG Chr19:8976795..8976814 59.57 50 CAAGGCACGGTAAGGAGAGA Chr19:8977060..8977079 60.39 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000621614 Chr19:8972580..8972649 AGCAAACCCGGTACAAGATG Chr19:8972595..8972614 59.99 50
upstream ENSMUSE00000621613 Chr19:8976754..8976858 TGGGGATTACACTTGCTGTG Chr19:8976795..8976814 59.57 50

*** Putative Vector Insertion (Chr 19: 8976859 - 8977011) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000621612 Chr19:8977012..8977120 CAAGGCACGGTAAGGAGAGA Chr19:8977060..8977079 60.39 55
downstream ENSMUSE00000621611 Chr19:8979425..8979552 GGGGTCAGCCACTAAAACAT Chr19:8979544..8979563 58.91 50
downstream ENSMUSE00000621610 Chr19:8981705..8981884 GAATGGCTGTGCTGTCAAAA Chr19:8981795..8981814 59.85 45
downstream ENSMUSE00000621589 Chr19:8982341..8982406 CTACCGAGCGCGAGACTAAC Chr19:8982376..8982395 60.18 60
downstream ENSMUSE00000621609 Chr19:8983168..8983237 CCTTCAGCTGGGTCTTTTGA Chr19:8983197..8983216 60.37 50
downstream ENSMUSE00000621608 Chr19:8983411..8983498 CTCCTGGCTCATCCTTCTCA Chr19:8983456..8983475 60.49 55
downstream ENSMUSE00000621607 Chr19:8983581..8983677 CCTGGCAGAGAAAAGTCCAA Chr19:8983620..8983639 60.37 50
downstream ENSMUSE00000621606 Chr19:8983923..8984103 TCAGCAGCATTAAGCCAGAA Chr19:8984069..8984088 59.71 45
downstream ENSMUSE00000621605 Chr19:8984956..8985109 CCCTGCAGGTAATCAAGCAT Chr19:8984993..8985012 60.1 50
downstream ENSMUSE00000621604 Chr19:8985198..8985433 TTGCCATCAGCATGTTCAAT Chr19:8985357..8985376 60.08 40
downstream ENSMUSE00000621603 Chr19:8985525..8985651 CCCTCGTAATCAGAGCCATC Chr19:8985640..8985659 59.65 55
downstream ENSMUSE00000621602 Chr19:8985767..8985846 TTAGACCACCAGGCCCTCAT Chr19:8985824..8985843 61.81 55
downstream ENSMUSE00000621601 Chr19:8986086..8986229 CACAGCATCCTTCAACATGG Chr19:8986178..8986197 60.11 50
downstream ENSMUSE00000621600 Chr19:8986354..8986450 GAGCGCTGTATTAGCCCATC Chr19:8986391..8986410 59.83 55
downstream ENSMUSE00000621599 Chr19:8986964..8987065 TGCCAGGCTGAGACACATAG Chr19:8987043..8987062 60.01 55
downstream ENSMUSE00000621598 Chr19:8987201..8987444 ATCTCGGATTGCATCTTGGT Chr19:8987364..8987383 59.51 45
downstream ENSMUSE00000621597 Chr19:8988791..8988855 No primer for this exon
downstream ENSMUSE00000621596 Chr19:8989032..8989108 GCATCCGATACAGGGTGAAT Chr19:8989068..8989087 59.78 50
downstream ENSMUSE00000621595 Chr19:8989192..8989266 CTGGCAGATACAAGGTCTGG Chr19:8989255..8989274 58.31 55
downstream ENSMUSE00000621594 Chr19:8989415..8989528 GGGGACTGAGAGCAACAAAG Chr19:8989529..8989548 59.84 55
downstream ENSMUSE00000621593 Chr19:8989648..8989760 ACAGGAACTCATGGCGAGTC Chr19:8989723..8989742 60.27 55
downstream ENSMUSE00000621592 Chr19:8989894..8989994 CAGCCCCCATGATGACTACT Chr19:8989964..8989983 59.95 55
downstream ENSMUSE00000621588 Chr19:8990115..8991153 GCCCTCCTAATTGTGTGGAA Chr19:8990863..8990882 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr19:8976909..8976929 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAATGGAAAGTGGGGACCTG Chr19:8976879..8976899 61.65 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000071650