Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19903
Trapped Gene
Dlg3 (ENSMUSG00000000881)
Vector Insertion
Chr X: 97992140 - 98001850
Public Clones (sanger) E022G06 (ggtc) (egtc)
Private Clones OST377589 (lexicon) OST147687 (lexicon)
Severity of mutation (?) Insertion after 33% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000207960 (ChrX:97992025..97992139 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000207960 (ChrX:97992025..97992139 +)
Downstram Exon
ENSMUSE00000207967 (ChrX:98001851..98002027 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000549357 ChrX:97963086..97963767 No primer for this exon
upstream ENSMUSE00000207980 ChrX:97966646..97966699 No primer for this exon
upstream ENSMUSE00000289766 ChrX:97966954..97967004 No primer for this exon
upstream ENSMUSE00000289760 ChrX:97967396..97967520 No primer for this exon
upstream ENSMUSE00000207966 ChrX:97967706..97967875 No primer for this exon
upstream ENSMUSE00000549384 ChrX:97968162..97968298 No primer for this exon
upstream ENSMUSE00000207965 ChrX:97968604..97968748 No primer for this exon
upstream ENSMUSE00000207990 ChrX:97969411..97969570 No primer for this exon
upstream ENSMUSE00000696825 ChrX:97970150..97970283 No primer for this exon
upstream ENSMUSE00000289733 ChrX:97971146..97971302 No primer for this exon
upstream ENSMUSE00000289731 ChrX:97971718..97971820 No primer for this exon
upstream ENSMUSE00000207960 ChrX:97992025..97992139 No primer for this exon

*** Putative Vector Insertion (Chr X: 97992140 - 98001850) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000207967 ChrX:98001851..98002027 No primer for this exon
downstream ENSMUSE00000289708 ChrX:98002519..98002594 No primer for this exon
downstream ENSMUSE00000696823 ChrX:98003392..98003491 No primer for this exon
downstream ENSMUSE00000289703 ChrX:98005201..98005246 No primer for this exon
downstream ENSMUSE00000207969 ChrX:98006841..98006882 No primer for this exon
downstream ENSMUSE00000289689 ChrX:98008065..98008115 No primer for this exon
downstream ENSMUSE00000549366 ChrX:98008676..98008777 No primer for this exon
downstream ENSMUSE00000549362 ChrX:98009543..98009715 No primer for this exon
downstream ENSMUSE00000207982 ChrX:98010132..98010241 No primer for this exon
downstream ENSMUSE00000207959 ChrX:98010547..98010638 No primer for this exon
downstream ENSMUSE00000289652 ChrX:98011558..98013747 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTCTCTCCGAACCAGTGAG ChrX:97995101..97995121 59.83 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTCTCTCCGAACCAGTGAG ChrX:97995101..97995121 59.83 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000881