Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19911
Trapped Gene
Arid1b (ENSMUSG00000069729)
Vector Insertion
Chr 17: 4996493 - 5040579
Public Clones not available
Private Clones OST377420 (lexicon) OST210641 (lexicon) OST132876 (lexicon) OST88789 (lexicon)
OST43456 (lexicon)
Severity of mutation (?) Insertion after 23% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000704213 (Chr17:4994939..4996492 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAGCAGCTAAACCAGTTCC Chr17:4995250..4995269 60.02 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000704213 (Chr17:4994939..4996492 +)
Downstram Exon
ENSMUSE00000704212 (Chr17:5040580..5040774 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAGCAGCTAAACCAGTTCC Chr17:4995250..4995269 60.02 55 CCCATCCCATACAACTGAGG Chr17:5040635..5040654 60.19 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000704213 Chr17:4994939..4996492 GCAGCAGCTAAACCAGTTCC Chr17:4995250..4995269 60.02 55
upstream ENSMUSE00000704207 Chr17:4996421..4996492 No primer for this exon
upstream ENSMUSE00000704206 Chr17:4996422..4996492 No primer for this exon

*** Putative Vector Insertion (Chr 17: 4996493 - 5040579) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000704212 Chr17:5040580..5040774 CCCATCCCATACAACTGAGG Chr17:5040635..5040654 60.19 55
downstream ENSMUSE00000658488 Chr17:5097574..5097732 GCGGCTGCTGGTTGTAGTAT Chr17:5097655..5097674 60.3 55
downstream ENSMUSE00000707557 Chr17:5126914..5127024 TCGATGGTCTTTCCTGTTGA Chr17:5127019..5127038 59.22 45
downstream ENSMUSE00000614511 Chr17:5242828..5243071 CTCCCTGGCTGCTTGTAGAC Chr17:5242924..5242943 60.01 60
downstream ENSMUSE00000614510 Chr17:5264032..5264121 GGGAACTGGATTCTGACTGG Chr17:5264085..5264104 59.51 55
downstream ENSMUSE00000614509 Chr17:5279203..5279382 TGCTGAGGTCCGTACTGAGA Chr17:5279260..5279279 59.57 55
downstream ENSMUSE00000704202 Chr17:5279215..5279382 TGCTGAGGTCCGTACTGAGA Chr17:5279260..5279279 59.57 55
downstream ENSMUSE00000614508 Chr17:5290956..5291283 TGGGGTTCTGGAGTAGTTGC Chr17:5290978..5290997 60.11 55
downstream ENSMUSE00000577466 Chr17:5305749..5305894 TCATCAGGCTGGAGTTGTTG Chr17:5305843..5305862 59.83 50
downstream ENSMUSE00000614507 Chr17:5311835..5311944 GGGACACGCCTTCTTCTTTA Chr17:5311927..5311946 59.31 50
downstream ENSMUSE00000614506 Chr17:5313874..5314032 GAAATGCCCTGAGAGCCATA Chr17:5313902..5313921 60.18 50
downstream ENSMUSE00000614505 Chr17:5318641..5318850 GCCAAACCTCCAATCTCCTT Chr17:5318849..5318868 60.44 50
downstream ENSMUSE00000614504 Chr17:5321273..5321477 AGCTCACGCCACTTCTTGTT Chr17:5321304..5321323 60.06 50
downstream ENSMUSE00000704201 Chr17:5321273..5321476 AGCTCACGCCACTTCTTGTT Chr17:5321304..5321323 60.06 50
downstream ENSMUSE00000658486 Chr17:5327276..5327414 GCTTTGCATGGGAGTCATCT Chr17:5327412..5327431 60.23 50
downstream ENSMUSE00000658485 Chr17:5327649..5327821 GCGTTTGGAGTCATGGAGTT Chr17:5327735..5327754 60.12 50
downstream ENSMUSE00000658484 Chr17:5332487..5332637 TGGTTCCATAGGGAAACTGC Chr17:5332627..5332646 59.93 50
downstream ENSMUSE00000658483 Chr17:5334964..5335060 CTGCTGTCCGTAAGCCTCAT Chr17:5334988..5335007 60.42 55
downstream ENSMUSE00000658482 Chr17:5336525..5337308 CGTGATTGATCCTCTGCTCA Chr17:5336942..5336961 59.94 50
downstream ENSMUSE00000658481 Chr17:5339216..5339346 CAGACCCGATTTAAGGGACA Chr17:5339265..5339284 59.93 50
downstream ENSMUSE00000658478 Chr17:5341363..5347656 AGCTCTCAGGGCAAACGATA Chr17:5346126..5346145 59.98 50
downstream ENSMUSE00000658480 Chr17:5341363..5343505 TGGGCAAGGTTCGATAAAAG Chr17:5342759..5342778 60.07 45
downstream ENSMUSE00000556742 Chr17:5341586..5343261 TGGGCAAGGTTCGATAAAAG Chr17:5342759..5342778 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCATACCTGCTGCTGTTCC Chr17:5023477..5023497 60.43 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCATACCTGCTGCTGTTCC Chr17:5023477..5023497 60.43 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000069729