Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19912
Trapped Gene
Srcrb4d (ENSMUSG00000029699)
Vector Insertion
Chr 5: 136436092 - 136437079
Public Clones not available
Private Clones OST377414 (lexicon) OST301604 (lexicon) OST295116 (lexicon)
Severity of mutation (?) Insertion after 82% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000686837 (Chr5:136436565..136437078 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGCCCGAGTCCTCTTACTG Chr5:136436608..136436627 60.01 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000686837 (Chr5:136436565..136437078 -)
Downstram Exon
ENSMUSE00000686844 (Chr5:136436093..136437078 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGCCCGAGTCCTCTTACTG Chr5:136436608..136436627 60.01 60 TCACGGTAAGGGTTTGAAGG Chr5:136436387..136436406 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000686848 Chr5:136450132..136450367 CCCTCCTAAAGTCCCTGGAG Chr5:136450192..136450211 60.06 60
upstream ENSMUSE00000686864 Chr5:136450132..136450401 CCCTCCTAAAGTCCCTGGAG Chr5:136450192..136450211 60.06 60
upstream ENSMUSE00000686845 Chr5:136446052..136446296 AACACGCAGGACCTTGAGTC Chr5:136446255..136446274 60.31 55
upstream ENSMUSE00000686863 Chr5:136446052..136446250 TCCTCCTTCTGTTCCCACTG Chr5:136446053..136446072 60.23 55
upstream ENSMUSE00000686861 Chr5:136444094..136444129 No primer for this exon
upstream ENSMUSE00000686839 Chr5:136443608..136443916 GATGCTAACGTGGTGTGTCG Chr5:136443793..136443812 60.18 55
upstream ENSMUSE00000686859 Chr5:136443608..136443913 GATGCTAACGTGGTGTGTCG Chr5:136443793..136443812 60.18 55
upstream ENSMUSE00000686856 Chr5:136441945..136442022 TACAGCCCTCCAAAATGGAA Chr5:136441948..136441967 60.44 45
upstream ENSMUSE00000686855 Chr5:136441441..136441755 CTGTATGCGACGATGACTGG Chr5:136441655..136441674 60.29 55
upstream ENSMUSE00000686854 Chr5:136440489..136440566 TTCTAAGCCCTCCGACTTCC Chr5:136440547..136440566 60.7 55
upstream ENSMUSE00000686853 Chr5:136439226..136439300 AGGAGTTGGTGCCTCACCTT Chr5:136439277..136439296 61.08 55
upstream ENSMUSE00000686851 Chr5:136438793..136439104 CTCAGCGACTGCTTCCATCT Chr5:136438849..136438868 60.7 55
upstream ENSMUSE00000421560 Chr5:136438070..136438141 ACGGCTTTCCCAAAACTAGC Chr5:136438102..136438121 60.61 50
upstream ENSMUSE00000686835 Chr5:136438070..136438197 ACGGCTTTCCCAAAACTAGC Chr5:136438102..136438121 60.61 50
upstream ENSMUSE00000388627 Chr5:136437759..136437836 GTTCTGAGACCACCCGAATG Chr5:136437781..136437800 60.51 55
upstream ENSMUSE00000686830 Chr5:136436692..136437078 CTCCGTCTGGCTAGTGGAAC Chr5:136437054..136437073 59.87 60
upstream ENSMUSE00000686837 Chr5:136436565..136437078 CTGCCCGAGTCCTCTTACTG Chr5:136436608..136436627 60.01 60
upstream ENSMUSE00000338710 Chr5:136436094..136437078 CTGCCCGAGTCCTCTTACTG Chr5:136436608..136436627 60.01 60
upstream ENSMUSE00000686844 Chr5:136436093..136437078 CTGCCCGAGTCCTCTTACTG Chr5:136436608..136436627 60.01 60

*** Putative Vector Insertion (Chr 5: 136436092 - 136437079) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000686850 Chr5:136436081..136437078 TCACGGTAAGGGTTTGAAGG Chr5:136436387..136436406 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCGTCTGGCTAGTGGAAC Chr5:136437052..136437072 59.87 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCGTCTGGCTAGTGGAAC Chr5:136437052..136437072 59.87 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029699