Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19923
Trapped Gene
Col13a1 (ENSMUSG00000058806)
Vector Insertion
Chr 10: 61382845 - 61424036
Public Clones IST10327F11 (tigm) IST12964D4 (tigm) IST14626B10 (tigm) IST10080E6 (tigm)
IST10949D4 (tigm) IST10080E5 (tigm) IST10080D6 (tigm) IST10235H11 (tigm)
IST14626B10 (tigm) IST14499H2 (tigm) IST12553E9 (tigm) IST10235H11 (tigm)
IST14358D9 (tigm)
Private Clones OST377080 (lexicon) OST309567 (lexicon)
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000666267 (Chr10:61424037..61424106 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGATGTAACTGCCCACCAG Chr10:61424037..61424056 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000666267 (Chr10:61424037..61424106 -)
Downstram Exon
ENSMUSE00000643176 (Chr10:61382837..61382844 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGATGTAACTGCCCACCAG Chr10:61424037..61424056 59.99 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000463034 Chr10:61441097..61441821 TCATTTTCGGTCCTCTTTGG Chr10:61441518..61441537 60.04 45
upstream ENSMUSE00000708439 Chr10:61441097..61441856 TCATTTTCGGTCCTCTTTGG Chr10:61441518..61441537 60.04 45
upstream ENSMUSE00000722030 Chr10:61441097..61441856 TCATTTTCGGTCCTCTTTGG Chr10:61441518..61441537 60.04 45
upstream ENSMUSE00000643124 Chr10:61440461..61440869 TGCCTGGTTTTATGGTCACA Chr10:61440710..61440729 59.96 45
upstream ENSMUSE00000100461 Chr10:61424037..61424106 AGGATGTAACTGCCCACCAG Chr10:61424037..61424056 59.99 55
upstream ENSMUSE00000666267 Chr10:61424037..61424106 AGGATGTAACTGCCCACCAG Chr10:61424037..61424056 59.99 55

*** Putative Vector Insertion (Chr 10: 61382845 - 61424036) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000643176 Chr10:61382837..61382844 No primer for this exon
downstream ENSMUSE00000576025 Chr10:61374455..61374481 GGAGTCCAGGTCTTCCAGTG Chr10:61374435..61374454 59.68 60
downstream ENSMUSE00000666266 Chr10:61374455..61374489 GGAGTCCAGGTCTTCCAGTG Chr10:61374435..61374454 59.68 60
downstream ENSMUSE00000100457 Chr10:61371430..61371465 No primer for this exon
downstream ENSMUSE00000100467 Chr10:61368002..61368028 CTTCTCGCCTGGTTGACCTT Chr10:61367980..61367999 61.71 55
downstream ENSMUSE00000514474 Chr10:61365838..61365888 No primer for this exon
downstream ENSMUSE00000420529 Chr10:61359887..61359922 ATCCAGGGAAACCTCGGGTA Chr10:61359870..61359889 62.84 55
downstream ENSMUSE00000576023 Chr10:61359094..61359120 No primer for this exon
downstream ENSMUSE00000576022 Chr10:61358082..61358108 No primer for this exon
downstream ENSMUSE00000100480 Chr10:61356782..61356808 No primer for this exon
downstream ENSMUSE00000481885 Chr10:61356663..61356689 TTCTCCCTTTTGTCCCTGAG Chr10:61356644..61356663 59.26 50
downstream ENSMUSE00000482853 Chr10:61355704..61355730 No primer for this exon
downstream ENSMUSE00000100454 Chr10:61353956..61354012 TAGGGACATTATCGGGTTGG Chr10:61353937..61353956 59.64 50
downstream ENSMUSE00000100456 Chr10:61352827..61352892 GGTCCGCCTTTTAATGACTG Chr10:61352811..61352830 59.57 50
downstream ENSMUSE00000100479 Chr10:61349997..61350104 TGGATGCCAGTCTGACTTTG Chr10:61350057..61350076 59.83 50
downstream ENSMUSE00000100453 Chr10:61348436..61348462 No primer for this exon
downstream ENSMUSE00000100450 Chr10:61347424..61347459 No primer for this exon
downstream ENSMUSE00000666270 Chr10:61340947..61341140 TCAGAGGCTTCGGTTTGTCT Chr10:61340944..61340963 59.99 50
downstream ENSMUSE00000378731 Chr10:61339016..61339060 No primer for this exon
downstream ENSMUSE00000576021 Chr10:61337486..61337518 No primer for this exon
downstream ENSMUSE00000576020 Chr10:61336742..61336768 No primer for this exon
downstream ENSMUSE00000576019 Chr10:61334038..61334082 No primer for this exon
downstream ENSMUSE00000100451 Chr10:61332909..61332995 CCAGCATCACCTTTTTCTCC Chr10:61332954..61332973 59.67 50
downstream ENSMUSE00000576018 Chr10:61332272..61332325 No primer for this exon
downstream ENSMUSE00000100477 Chr10:61330579..61330623 CAGAGGGTCCCTGTTCACCA Chr10:61330565..61330584 63.48 60
downstream ENSMUSE00000100476 Chr10:61330200..61330268 CTCGTTGATGCTGCCATTAT Chr10:61330187..61330206 58.75 45
downstream ENSMUSE00000468595 Chr10:61329139..61329162 No primer for this exon
downstream ENSMUSE00000274964 Chr10:61326689..61326751 TGTTTGTCCAGGAAGACCAG Chr10:61326703..61326722 58.69 50
downstream ENSMUSE00000100473 Chr10:61325792..61325836 No primer for this exon
downstream ENSMUSE00000576005 Chr10:61325496..61325519 No primer for this exon
downstream ENSMUSE00000518217 Chr10:61325376..61325519 GCCCCATATCTCCTGGTTTT Chr10:61325467..61325486 60.15 50
downstream ENSMUSE00000576004 Chr10:61325376..61325490 GGTCCGACTTCTCCCTTCAT Chr10:61325403..61325422 60.46 55
downstream ENSMUSE00000100452 Chr10:61324763..61324861 TTCGTCACCTGGTTCTCCTT Chr10:61324795..61324814 59.7 50
downstream ENSMUSE00000643138 Chr10:61323188..61323232 CTCCCCAGCTTCTCCTTTCT Chr10:61323187..61323206 59.95 55
downstream ENSMUSE00000643158 Chr10:61323188..61323232 CTCCCCAGCTTCTCCTTTCT Chr10:61323187..61323206 59.95 55
downstream ENSMUSE00000643136 Chr10:61320336..61320377 No primer for this exon
downstream ENSMUSE00000643155 Chr10:61320336..61320377 No primer for this exon
downstream ENSMUSE00000643134 Chr10:61319530..61319556 TTTGGTCCAGGAAAACCTTG Chr10:61319509..61319528 59.94 45
downstream ENSMUSE00000643154 Chr10:61319530..61319556 TTTGGTCCAGGAAAACCTTG Chr10:61319509..61319528 59.94 45
downstream ENSMUSE00000643133 Chr10:61319086..61319166 GGGAGCCCTTCTCTCCTTTA Chr10:61319102..61319121 59.78 55
downstream ENSMUSE00000643153 Chr10:61319086..61319166 GGGAGCCCTTCTCTCCTTTA Chr10:61319102..61319121 59.78 55
downstream ENSMUSE00000576013 Chr10:61316105..61316140 No primer for this exon
downstream ENSMUSE00000643131 Chr10:61313860..61313913 No primer for this exon
downstream ENSMUSE00000643152 Chr10:61313860..61313913 No primer for this exon
downstream ENSMUSE00000643129 Chr10:61312905..61312958 No primer for this exon
downstream ENSMUSE00000643151 Chr10:61312905..61312958 No primer for this exon
downstream ENSMUSE00000643128 Chr10:61311924..61311959 No primer for this exon
downstream ENSMUSE00000643150 Chr10:61311924..61311959 No primer for this exon
downstream ENSMUSE00000666265 Chr10:61311804..61311959 GCACGAGGGCTCAGACTTAC Chr10:61311882..61311901 60.02 60
downstream ENSMUSE00000420534 Chr10:61311480..61311959 GCACGAGGGCTCAGACTTAC Chr10:61311882..61311901 60.02 60
downstream ENSMUSE00000643127 Chr10:61306316..61306402 GCCCTCTAGAGCCCTTCTTC Chr10:61306350..61306369 59.56 60
downstream ENSMUSE00000643149 Chr10:61306316..61306402 GCCCTCTAGAGCCCTTCTTC Chr10:61306350..61306369 59.56 60
downstream ENSMUSE00000643126 Chr10:61302826..61302864 CCTTGGACTGGTAAGCCATC Chr10:61302817..61302836 59.55 55
downstream ENSMUSE00000643148 Chr10:61302826..61302864 CCTTGGACTGGTAAGCCATC Chr10:61302817..61302836 59.55 55
downstream ENSMUSE00000666264 Chr10:61301246..61301456 GTCCCAGGTTAGAGGCATCA Chr10:61301415..61301434 60.07 55
downstream ENSMUSE00000666271 Chr10:61301246..61301456 GTCCCAGGTTAGAGGCATCA Chr10:61301415..61301434 60.07 55
downstream ENSMUSE00000576010 Chr10:61300984..61301456 TGCAACATTAGGAGCAGACG Chr10:61301192..61301211 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGGATTAACTGCCTGTTG Chr10:61385006..61385026 60.88 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGGATTAACTGCCTGTTG Chr10:61385006..61385026 60.88 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTAATCGCCTTGCAGCACATC Chr10:61385036..61385057 62.97 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAGTCGATGAAATCCGTGAC Chr10:61385050..61385070 59.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058806