Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19933
Trapped Gene
Ccdc61 (ENSMUSG00000074358)
Vector Insertion
Chr 7: 19489289 - 19495481
Public Clones (sanger) (sanger) (sanger) (ggtc) D074G10 (ggtc) D074G10 (ggtc)
Private Clones OST376780 (lexicon) OST259815 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000636985 (Chr7:19495482..19495753 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGGTGAAGAGCGAGTACG Chr7:19495687..19495706 60.01 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000636985 (Chr7:19495482..19495753 -)
Downstram Exon
ENSMUSE00000636984 (Chr7:19489131..19489288 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGGTGAAGAGCGAGTACG Chr7:19495687..19495706 60.01 60 CACACCCCGGAAGATGTAGT Chr7:19489209..19489228 59.84 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000636985 Chr7:19495482..19495753 GGAGGTGAAGAGCGAGTACG Chr7:19495687..19495706 60.01 60

*** Putative Vector Insertion (Chr 7: 19489289 - 19495481) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000636984 Chr7:19489131..19489288 CACACCCCGGAAGATGTAGT Chr7:19489209..19489228 59.84 55
downstream ENSMUSE00000636982 Chr7:19488819..19488901 TTCCCCGTCTTATGAGTCAAG Chr7:19488849..19488869 59.18 47.62
downstream ENSMUSE00000636981 Chr7:19486268..19486425 GGTAGCGTTTGGAGTTGAGC Chr7:19486277..19486296 59.88 55
downstream ENSMUSE00000636980 Chr7:19484907..19485062 CCTCGAAGATGACCCAACTC Chr7:19484939..19484958 59.65 55
downstream ENSMUSE00000636979 Chr7:19479284..19479494 CTGCCGTAACTCCAGCTCTA Chr7:19479328..19479347 58.28 55
downstream ENSMUSE00000636978 Chr7:19479116..19479198 GCTCGCTGTTCAGTGTCTTG Chr7:19479113..19479132 59.78 55
downstream ENSMUSE00000636977 Chr7:19478534..19478697 GTGATGAGGAGCGAGTGACC Chr7:19478575..19478594 60.84 60
downstream ENSMUSE00000636976 Chr7:19478347..19478422 TTGGCTTTCACAAAGGCTGT Chr7:19478355..19478374 60.81 45
downstream ENSMUSE00000636975 Chr7:19477787..19477932 TCTGCTGAGACCATGAGACG Chr7:19477834..19477853 60.14 55
downstream ENSMUSE00000636974 Chr7:19477623..19477701 AGGAGCTGACTGACGAGCAG Chr7:19477641..19477660 60.9 60
downstream ENSMUSE00000636971 Chr7:19477388..19477448 GTGTCGGACTGGGTGGTTTC Chr7:19477386..19477405 62.76 60
downstream ENSMUSE00000636970 Chr7:19476664..19476736 GGTGATCACTGCGTTCTTGA Chr7:19476684..19476703 59.84 50
downstream ENSMUSE00000636969 Chr7:19476233..19476522 CAGCCGGTTCATGTATTCCT Chr7:19476418..19476437 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGTAATCGCCTTGCAGCAC Chr7:19495413..19495433 61.78 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAACCCTTACCGAATACTGCAC Chr7:19495493..19495515 59.9 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGTGGGTGTTAAGGGGGAGT Chr7:19495734..19495754 59.72 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GCTGCCTGTAAGATCAGACCA Chr7:19495780..19495801 60.41 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074358