Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19934
Trapped Gene
RP23-366K1.1 (ENSMUSG00000070291)
Vector Insertion
Chr 9: 78243934 - 78246847
Public Clones not available
Private Clones OST376763 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000695306 (Chr9:78243584..78243933 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTGCAGCTGAGTCTGGAAC Chr9:78243637..78243656 60.19 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000695306 (Chr9:78243584..78243933 +)
Downstram Exon
ENSMUSE00000695305 (Chr9:78246848..78246903 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTGCAGCTGAGTCTGGAAC Chr9:78243637..78243656 60.19 55 AATTTTTGACCCACCACGAC Chr9:78246870..78246889 59.69 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000695306 Chr9:78243584..78243933 TGTGCAGCTGAGTCTGGAAC Chr9:78243637..78243656 60.19 55

*** Putative Vector Insertion (Chr 9: 78243934 - 78246847) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000695305 Chr9:78246848..78246903 AATTTTTGACCCACCACGAC Chr9:78246870..78246889 59.69 45
downstream ENSMUSE00000695303 Chr9:78248656..78248782 GCTTTTGTTTGCATGGCTTT Chr9:78248723..78248742 60.25 40
downstream ENSMUSE00000583882 Chr9:78248707..78248782 No primer for this exon
downstream ENSMUSE00000583881 Chr9:78250157..78250288 TCCAACGGTAGGTTGGAATG Chr9:78250188..78250207 60.74 50
downstream ENSMUSE00000583880 Chr9:78254158..78254239 TTGAGCTTGTCGTTGCTGAC Chr9:78254214..78254233 60.18 50
downstream ENSMUSE00000583879 Chr9:78259399..78259555 GGATAGGACGCTTCTCACCA Chr9:78259460..78259479 60.22 55
downstream ENSMUSE00000583878 Chr9:78260000..78260118 GAACTATTGGCCATGCCTGT Chr9:78260024..78260043 59.96 50
downstream ENSMUSE00000583877 Chr9:78260773..78260883 CAGGCCCATTTCTTTGTTCT Chr9:78260801..78260820 59.17 45
downstream ENSMUSE00000583876 Chr9:78261550..78261691 CCATCTCTATCACCACCACCA Chr9:78261584..78261604 60.78 52.38
downstream ENSMUSE00000583875 Chr9:78262031..78262131 GGTTCAAATCCCATGTCCAG Chr9:78262077..78262096 60.17 50
downstream ENSMUSE00000583874 Chr9:78264470..78264557 GACGGCATATGGCCAAGTAG Chr9:78264494..78264513 60.49 55
downstream ENSMUSE00000583873 Chr9:78265844..78265971 ATTCTCGAGGAAGGTCTGGA Chr9:78265927..78265946 58.82 50
downstream ENSMUSE00000583872 Chr9:78266140..78266249 ACGCTTTCTCTCGGTCACTC Chr9:78266234..78266253 59.6 55
downstream ENSMUSE00000583871 Chr9:78267019..78267157 ACCTCGAGATGCCAAGTCAG Chr9:78267065..78267084 60.41 55
downstream ENSMUSE00000583870 Chr9:78268396..78268483 GGCAACCCTCCAATCATTTC Chr9:78268450..78268469 61.59 50
downstream ENSMUSE00000583869 Chr9:78269505..78269645 GGGCTTTCCTTGAGGTCTTC Chr9:78269606..78269625 60.19 55
downstream ENSMUSE00000695293 Chr9:78271259..78271394 AGAATCAGCCAAGTCTCTCCA Chr9:78271328..78271348 59.03 47.62

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr9:78243984..78244004 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTCGGGGTGAAGAACGATG Chr9:78243897..78243917 62.87 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000070291