Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19951
Trapped Gene
Cdc40 (ENSMUSG00000038446)
Vector Insertion
Chr 10: 40587717 - 40602692
Public Clones (sanger) IST14884H10 (tigm)
Private Clones OST376586 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000408235 (Chr10:40602693..40602915 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATCGGATTCGGACAGTGAG Chr10:40602807..40602826 60.07 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000408235 (Chr10:40602693..40602915 -)
Downstram Exon
ENSMUSE00000299432 (Chr10:40587630..40587716 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATCGGATTCGGACAGTGAG Chr10:40602807..40602826 60.07 50 AGCAGGGTCAAGGTGAACTC Chr10:40587659..40587678 59.31 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000408235 Chr10:40602693..40602915 AATCGGATTCGGACAGTGAG Chr10:40602807..40602826 60.07 50

*** Putative Vector Insertion (Chr 10: 40587717 - 40602692) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000299432 Chr10:40587630..40587716 AGCAGGGTCAAGGTGAACTC Chr10:40587659..40587678 59.31 55
downstream ENSMUSE00000299423 Chr10:40577353..40577482 CATTGATGTGTGCTGGCTCT Chr10:40577373..40577392 59.86 50
downstream ENSMUSE00000299414 Chr10:40572303..40572386 CTTCTCCGCTTCTTCCACAG Chr10:40572288..40572307 60.13 55
downstream ENSMUSE00000299405 Chr10:40570736..40570875 GGTTTGGCCACATCTTTTTC Chr10:40570721..40570740 59.41 45
downstream ENSMUSE00000299396 Chr10:40569551..40569647 CTTCTCCTCCCCAGGTTTCT Chr10:40569542..40569561 59.67 55
downstream ENSMUSE00000299386 Chr10:40567730..40567869 CCAGACCACACGTGAATTTG Chr10:40567718..40567737 60 50
downstream ENSMUSE00000299376 Chr10:40566936..40567010 AGTCCATGGAGCAAGACAGC Chr10:40566925..40566944 60.42 55
downstream ENSMUSE00000299368 Chr10:40564767..40564812 GCCGGTCTCCATAAACTTCC Chr10:40564766..40564785 60.83 55
downstream ENSMUSE00000299363 Chr10:40562848..40562949 CTGTCTCGGTGTCCCAGAGT Chr10:40562826..40562845 60.31 60
downstream ENSMUSE00000299355 Chr10:40561506..40561621 GGGATTGAACTTGACGCAGT Chr10:40561541..40561560 60.12 50
downstream ENSMUSE00000299345 Chr10:40561160..40561293 CCCAGATGCCGATCATATTC Chr10:40561222..40561241 60.26 50
downstream ENSMUSE00000299340 Chr10:40556094..40556170 TGCTGGGCTCTGCTATGTACT Chr10:40556108..40556128 60.05 52.38
downstream ENSMUSE00000464075 Chr10:40553982..40554126 AGCGTAGCCTGCTACCATGT Chr10:40553989..40554008 59.93 55
downstream ENSMUSE00000644056 Chr10:40551432..40553162 GCTAGGCAGTGCAATGTTCA Chr10:40551686..40551705 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGATGCCAGCCATAGTGAA Chr10:40587643..40587663 59.68 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGTGTTCTGTCGCCAATG Chr10:40602702..40602722 58.88 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTTGAAGTGTTTGGGCAGTGT Chr10:40587930..40587951 60.2 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGAAGTGTTTGGGCAGTGTT Chr10:40602929..40602949 59.19 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038446