Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19955
Trapped Gene
Slc25a38 (ENSMUSG00000032519)
Vector Insertion
Chr 9: 120025742 - 120026570
Public Clones IST14662C8 (tigm)
Private Clones OST376535 (lexicon) OST329489 (lexicon) OST238503 (lexicon) OST45850 (lexicon)
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000528232 (Chr9:120025620..120025741 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCTCCTCAAAACCCGTCTG Chr9:120025696..120025715 59.14 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000528232 (Chr9:120025620..120025741 +)
Downstram Exon
ENSMUSE00000372567 (Chr9:120026571..120026655 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCTCCTCAAAACCCGTCTG Chr9:120025696..120025715 59.14 50 GGAGACTTTCTGTGCGAACC Chr9:120026632..120026651 59.85 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000351566 Chr9:120019517..120019690 TGCAGTCGCAGGATGTAGAG Chr9:120019650..120019669 60.16 55
upstream ENSMUSE00000528232 Chr9:120025620..120025741 ATCTCCTCAAAACCCGTCTG Chr9:120025696..120025715 59.14 50

*** Putative Vector Insertion (Chr 9: 120025742 - 120026570) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000372567 Chr9:120026571..120026655 GGAGACTTTCTGTGCGAACC Chr9:120026632..120026651 59.85 55
downstream ENSMUSE00000220423 Chr9:120029375..120029554 TGATGGGTGACATGCAGACT Chr9:120029534..120029553 60.12 50
downstream ENSMUSE00000220417 Chr9:120029791..120029965 ATCACGGAGGAGAGTTGCTG Chr9:120029901..120029920 60.41 55
downstream ENSMUSE00000220420 Chr9:120031212..120031378 TCACGTCTGCAGGTTGAGTC Chr9:120031310..120031329 60.03 55
downstream ENSMUSE00000353169 Chr9:120032760..120033435 AGAGTAGGCAGGTGGCTGAA Chr9:120033165..120033184 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTCAGACCTAGGGTAGGC Chr9:120025729..120025749 60.09 65 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGAGGAGCCAGGATTAAAG Chr9:120025763..120025783 59.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032519