Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19967
Trapped Gene
Prkcd (ENSMUSG00000021948)
Vector Insertion
Chr 14: 31423373 - 31423497
Public Clones not available
Private Clones OST376237 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000719030 (Chr14:31423374..31423496 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGTTGAGGACGAAGCAAGC Chr14:31423417..31423436 59.62 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000719030 (Chr14:31423374..31423496 -)
Downstram Exon
ENSMUSE00000715335 (Chr14:31423374..31423496 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGTTGAGGACGAAGCAAGC Chr14:31423417..31423436 59.62 50 GCTTGCTTCGTCCTCAACTT Chr14:31423395..31423414 59.62 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000690842 Chr14:31439166..31439396 CCGGATCAGACTTGTGCCTA Chr14:31439255..31439274 61.2 55
upstream ENSMUSE00000562907 Chr14:31423374..31423498 AAGTTGAGGACGAAGCAAGC Chr14:31423417..31423436 59.62 50
upstream ENSMUSE00000690789 Chr14:31423374..31423488 AAGTTGAGGACGAAGCAAGC Chr14:31423417..31423436 59.62 50
upstream ENSMUSE00000715335 Chr14:31423374..31423496 AAGTTGAGGACGAAGCAAGC Chr14:31423417..31423436 59.62 50
upstream ENSMUSE00000719030 Chr14:31423374..31423496 AAGTTGAGGACGAAGCAAGC Chr14:31423417..31423436 59.62 50

*** Putative Vector Insertion (Chr 14: 31423373 - 31423497) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000122412 Chr14:31422288..31422487 CTGGATAACACGGCCTTCAT Chr14:31422371..31422390 59.96 50
downstream ENSMUSE00000690780 Chr14:31422288..31422487 CTGGATAACACGGCCTTCAT Chr14:31422371..31422390 59.96 50
downstream ENSMUSE00000242306 Chr14:31420794..31420854 CCCCATCCTCCAGGAAATAC Chr14:31420772..31420791 60.52 55
downstream ENSMUSE00000690778 Chr14:31420794..31420854 CCCCATCCTCCAGGAAATAC Chr14:31420772..31420791 60.52 55
downstream ENSMUSE00000690786 Chr14:31420794..31421008 AGGGGGATGACAAATCAGTG Chr14:31420846..31420865 59.78 50
downstream ENSMUSE00000242298 Chr14:31420474..31420636 AAGGTGGCGATAAACTCGTG Chr14:31420497..31420516 60.13 50
downstream ENSMUSE00000242294 Chr14:31420349..31420380 TTGTAGCCTTGCTTGTTGAGG Chr14:31420335..31420355 60.43 47.62
downstream ENSMUSE00000242286 Chr14:31419002..31419087 CGGCCGATAATCTTGTCAAT Chr14:31419017..31419036 59.92 45
downstream ENSMUSE00000242277 Chr14:31418626..31418755 TGTCGATGTTGAAGCGTTCT Chr14:31418706..31418725 59.44 45
downstream ENSMUSE00000242270 Chr14:31417293..31417393 CTGGGTCACTTGGTTCAAGG Chr14:31417271..31417290 60.54 55
downstream ENSMUSE00000361748 Chr14:31415923..31416013 GCTTCTTCTCAAATCCCTGGT Chr14:31415928..31415948 59.71 47.62
downstream ENSMUSE00000690812 Chr14:31415845..31416013 CTGCTGGGGAATGATAGCTT Chr14:31415855..31415874 59.29 50
downstream ENSMUSE00000242250 Chr14:31415500..31415600 CCTCCCAGATCTTGCCATAG Chr14:31415546..31415565 59.65 55
downstream ENSMUSE00000562921 Chr14:31415219..31415392 CAACACCACGTCCTTCTTCA Chr14:31415299..31415318 59.72 50
downstream ENSMUSE00000122370 Chr14:31414946..31415037 TCCATCACGAAGAACAGGTG Chr14:31414993..31415012 59.68 50
downstream ENSMUSE00000122365 Chr14:31414355..31414417 AACTGCAGTCCGCAGATGAT Chr14:31414360..31414379 60.83 50
downstream ENSMUSE00000562915 Chr14:31412796..31412934 TCACATTGTCCAGCTTGAGG Chr14:31412890..31412909 59.83 50
downstream ENSMUSE00000562912 Chr14:31412504..31412692 GTGATCCAACGGGGATAGTG Chr14:31412510..31412529 60.19 55
downstream ENSMUSE00000122362 Chr14:31411904..31412032 TCAGGGTCCCTCTCGAATAG Chr14:31411991..31412010 59.23 55
downstream ENSMUSE00000690777 Chr14:31411698..31411814 ACATACACAGCATGCCAGGA Chr14:31411753..31411772 60.14 50
downstream ENSMUSE00000690774 Chr14:31411593..31411814 GCTACATTCCCCAGCTCAAG Chr14:31411653..31411672 59.84 55
downstream ENSMUSE00000690784 Chr14:31408780..31409211 CAGCAGAAATCAGCCAGTCA Chr14:31408924..31408943 60.14 50
downstream ENSMUSE00000690785 Chr14:31408778..31409211 CAGCAGAAATCAGCCAGTCA Chr14:31408924..31408943 60.14 50
downstream ENSMUSE00000393493 Chr14:31408555..31409211 CAGCAGAAATCAGCCAGTCA Chr14:31408924..31408943 60.14 50
downstream ENSMUSE00000690790 Chr14:31408545..31409211 CAGCAGAAATCAGCCAGTCA Chr14:31408924..31408943 60.14 50
downstream ENSMUSE00000690788 Chr14:31408544..31409211 CAGCAGAAATCAGCCAGTCA Chr14:31408924..31408943 60.14 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCTCACTCCAGGCTCCATC Chr14:31423487..31423507 59.21 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCTCACTCCAGGCTCCATC Chr14:31423487..31423507 59.21 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021948