Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19977
Trapped Gene
Ncoa5 (ENSMUSG00000039804)
Vector Insertion
Chr 2: 164848713 - 164860182
Public Clones (sanger) IST14863A7 (tigm) IST14942D5 (tigm) IST14945D10 (tigm) IST14892F7 (tigm)
IST14599H1 (tigm) IST14951A10 (tigm) IST14802G12 (tigm) IST11993H10 (tigm)
IST14827A7 (tigm) IST14893A10 (tigm) IST14953H6 (tigm) IST13633A3 (tigm)
IST14953A12 (tigm) IST14945D11 (tigm) IST14855A12 (tigm) IST14832G11 (tigm)
IST14928B3 (tigm) IST13606A5 (tigm) IST13063H3 (tigm) IST14928E1 (tigm)
Private Clones OST376092 (lexicon) OST184799 (lexicon) OST98051 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000488296 (Chr2:164860183..164860279 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000488296 (Chr2:164860183..164860279 -)
Downstram Exon
ENSMUSE00000487387 (Chr2:164848646..164848712 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TTCTTCTTTCCGCTGCCTTA Chr2:164848664..164848683 60.09 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000488296 Chr2:164860183..164860279 No primer for this exon
upstream ENSMUSE00000719097 Chr2:164860183..164860288 No primer for this exon
upstream ENSMUSE00000721865 Chr2:164860183..164860317 No primer for this exon

*** Putative Vector Insertion (Chr 2: 164848713 - 164860182) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000487387 Chr2:164848646..164848712 TTCTTCTTTCCGCTGCCTTA Chr2:164848664..164848683 60.09 45
downstream ENSMUSE00000712365 Chr2:164848646..164848712 TTCTTCTTTCCGCTGCCTTA Chr2:164848664..164848683 60.09 45
downstream ENSMUSE00000240490 Chr2:164838336..164838662 GATCACGAAAGTCCCGAAAA Chr2:164838402..164838421 60.05 45
downstream ENSMUSE00000709565 Chr2:164838336..164838662 GATCACGAAAGTCCCGAAAA Chr2:164838402..164838421 60.05 45
downstream ENSMUSE00000240478 Chr2:164835951..164836087 TTCCTCCGGCAATAGTCATC Chr2:164836012..164836031 60.04 50
downstream ENSMUSE00000240471 Chr2:164834823..164834949 TCGCTGGATCTCCTCAAAAT Chr2:164834860..164834879 59.77 45
downstream ENSMUSE00000721446 Chr2:164834823..164834949 TCGCTGGATCTCCTCAAAAT Chr2:164834860..164834879 59.77 45
downstream ENSMUSE00000240463 Chr2:164829597..164829796 GAGGAAGATCAGGTCCACGA Chr2:164829708..164829727 60.2 55
downstream ENSMUSE00000711856 Chr2:164829589..164829796 GAGGAAGATCAGGTCCACGA Chr2:164829708..164829727 60.2 55
downstream ENSMUSE00000240453 Chr2:164828139..164828459 TCTCCTCGGCAGTGAGGTAT Chr2:164828189..164828208 59.83 55
downstream ENSMUSE00000720930 Chr2:164828139..164828459 TCTCCTCGGCAGTGAGGTAT Chr2:164828189..164828208 59.83 55
downstream ENSMUSE00000715773 Chr2:164828116..164828459 TCTCCTCGGCAGTGAGGTAT Chr2:164828189..164828208 59.83 55
downstream ENSMUSE00000639203 Chr2:164825868..164827671 AGAAATCACGGACCACCAAG Chr2:164826299..164826318 59.97 50
downstream ENSMUSE00000708689 Chr2:164825863..164827671 AGAAATCACGGACCACCAAG Chr2:164826299..164826318 59.97 50
downstream ENSMUSE00000714900 Chr2:164825860..164827671 AGAAATCACGGACCACCAAG Chr2:164826299..164826318 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCAGCACAGATTTCCAGAGG Chr2:164860163..164860183 58.96 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAGCACAGATTTCCAGAGG Chr2:164860163..164860183 58.96 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AAATAATCGCCTTGCAGCAC Chr2:164860212..164860232 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GCAGACAACTTTGACAGAGCA Chr2:164860261..164860282 59.23 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039804