Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19979
Trapped Gene
Shf (ENSMUSG00000033256)
Vector Insertion
Chr 2: 122175276 - 122179500
Public Clones not available
Private Clones OST376058 (lexicon)
Severity of mutation (?) Insertion after 81% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000721028 (Chr2:122179501..122179620 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAACAGTGAGACCAGCAAA Chr2:122179524..122179543 60.03 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000721028 (Chr2:122179501..122179620 -)
Downstram Exon
ENSMUSE00000714297 (Chr2:122174935..122175275 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAACAGTGAGACCAGCAAA Chr2:122179524..122179543 60.03 50 TAGTGGTGCACGATTTCAGG Chr2:122175143..122175162 59.72 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000684301 Chr2:122194383..122194568 CGACTTCGAGGACCCCTACT Chr2:122194544..122194563 60.64 60
upstream ENSMUSE00000446894 Chr2:122192420..122192564 GAAAAGCGAAGCCAGACAAG Chr2:122192420..122192439 60.13 50
upstream ENSMUSE00000289917 Chr2:122185184..122185325 AGGAGACTGGTGAAGGCTCA Chr2:122185266..122185285 59.99 55
upstream ENSMUSE00000684300 Chr2:122185184..122185325 AGGAGACTGGTGAAGGCTCA Chr2:122185266..122185285 59.99 55
upstream ENSMUSE00000684291 Chr2:122183930..122183945 No primer for this exon
upstream ENSMUSE00000716804 Chr2:122183930..122183976 GGCACTGGAAAAGAGCAGAT Chr2:122183957..122183976 59.43 50
upstream ENSMUSE00000289910 Chr2:122182819..122183025 TCCGGGGTTCTAAGGAGACT Chr2:122183003..122183022 60.07 55
upstream ENSMUSE00000684298 Chr2:122181211..122181351 GGTCATCAAAGACCTACCTTGG Chr2:122181320..122181341 59.86 50
upstream ENSMUSE00000715189 Chr2:122179767..122179933 CCAGTTTGAAGGATCGGAGA Chr2:122179913..122179932 60.19 50
upstream ENSMUSE00000289904 Chr2:122179765..122179933 CCAGTTTGAAGGATCGGAGA Chr2:122179913..122179932 60.19 50
upstream ENSMUSE00000289894 Chr2:122179501..122179620 GCAACAGTGAGACCAGCAAA Chr2:122179524..122179543 60.03 50
upstream ENSMUSE00000721028 Chr2:122179501..122179620 GCAACAGTGAGACCAGCAAA Chr2:122179524..122179543 60.03 50

*** Putative Vector Insertion (Chr 2: 122175276 - 122179500) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000714297 Chr2:122174935..122175275 TAGTGGTGCACGATTTCAGG Chr2:122175143..122175162 59.72 50
downstream ENSMUSE00000389234 Chr2:122174629..122175275 TAGTGGTGCACGATTTCAGG Chr2:122175143..122175162 59.72 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTTAATCGCCTTGCAGCAC Chr2:122176432..122176452 61.26 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TATTTCGTGACTGGGAAAACC Chr2:122176433..122176454 58.94 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033256