Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19981
Trapped Gene
Was (ENSMUSG00000031165)
Vector Insertion
Chr X: 7667111 - 7667416
Public Clones not available
Private Clones OST375996 (lexicon)
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000240455 (ChrX:7667417..7667578 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCGTTCAGCAGAACATTCCT ChrX:7667480..7667499 60.26 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000240455 (ChrX:7667417..7667578 -)
Downstram Exon
ENSMUSE00000240445 (ChrX:7666970..7667110 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCGTTCAGCAGAACATTCCT ChrX:7667480..7667499 60.26 50 TGCCAGGTAGAGCTGAACAA ChrX:7667053..7667072 59.59 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000240455 ChrX:7667417..7667578 CCGTTCAGCAGAACATTCCT ChrX:7667480..7667499 60.26 50

*** Putative Vector Insertion (Chr X: 7667111 - 7667416) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000240445 ChrX:7666970..7667110 TGCCAGGTAGAGCTGAACAA ChrX:7667053..7667072 59.59 50
downstream ENSMUSE00000206999 ChrX:7666382..7666468 TCCAGCAAAAGTGTGGAAGA ChrX:7666363..7666382 59.42 45
downstream ENSMUSE00000206996 ChrX:7666162..7666264 CATCCGCAAAGTTCAGTCCT ChrX:7666212..7666231 60.26 50
downstream ENSMUSE00000206995 ChrX:7666000..7666041 CTCATTGATTGGTGCTGGTG ChrX:7665979..7665998 60.11 50
downstream ENSMUSE00000206994 ChrX:7665850..7665903 No primer for this exon
downstream ENSMUSE00000240412 ChrX:7664887..7665061 GCTCCGATATCAGCTTTGCT ChrX:7664880..7664899 59.58 50
downstream ENSMUSE00000240405 ChrX:7664056..7664098 No primer for this exon
downstream ENSMUSE00000240397 ChrX:7663690..7663843 GCCTCTAGACCTCCCTGGTC ChrX:7663694..7663713 60.22 65
downstream ENSMUSE00000381489 ChrX:7662968..7663422 CATAGGTACAGGGGGCAGTG ChrX:7663246..7663265 60.39 60
downstream ENSMUSE00000206993 ChrX:7662632..7662746 ACATGCATCAGGGCACCTAC ChrX:7662645..7662664 60.96 55
downstream ENSMUSE00000366246 ChrX:7658600..7659115 GCAAGATCAAAGCCAAAAGG ChrX:7658776..7658795 59.82 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGAAAATGCTGGGTGAGTTG ChrX:7667407..7667427 61.6 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGAAAATGCTGGGTGAGTTG ChrX:7667407..7667427 61.6 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031165