Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19982
Trapped Gene
Bak1 (ENSMUSG00000057789)
Vector Insertion
Chr 17: 27162839 - 27165355
Public Clones IST10114C5 (tigm) IST14197C8 (tigm) IST14553B4 (tigm)
Private Clones OST375955 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000657950 (Chr17:27165356..27165523 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCACCATGAATCCACTGA Chr17:27165473..27165492 60.69 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000657950 (Chr17:27165356..27165523 -)
Downstram Exon
ENSMUSE00000348899 (Chr17:27162738..27162838 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCACCATGAATCCACTGA Chr17:27165473..27165492 60.69 50 GTCCTTGTCCAGATGCCATT Chr17:27162761..27162780 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000657950 Chr17:27165356..27165523 CAGCACCATGAATCCACTGA Chr17:27165473..27165492 60.69 50
upstream ENSMUSE00000657952 Chr17:27165356..27165571 TGGGACCTCCTCTATGGTCA Chr17:27165540..27165559 60.47 55

*** Putative Vector Insertion (Chr 17: 27162839 - 27165355) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000348899 Chr17:27162738..27162838 GTCCTTGTCCAGATGCCATT Chr17:27162761..27162780 59.93 50
downstream ENSMUSE00000249303 Chr17:27159687..27159822 CCTGCTGGTGGAGGTAAAAA Chr17:27159735..27159754 60.1 50
downstream ENSMUSE00000139555 Chr17:27159384..27159527 TCGTAGCGCCGGTTAATATC Chr17:27159443..27159462 60.08 50
downstream ENSMUSE00000488015 Chr17:27158608..27158627 No primer for this exon
downstream ENSMUSE00000409676 Chr17:27158112..27158292 GGTAGACGTACAGGGCCAGA Chr17:27158191..27158210 60.13 60
downstream ENSMUSE00000487133 Chr17:27158112..27158292 GGTAGACGTACAGGGCCAGA Chr17:27158191..27158210 60.13 60
downstream ENSMUSE00000657949 Chr17:27156759..27157980 ACCATGCAATGTTGGGGTAT Chr17:27157663..27157682 59.94 45
downstream ENSMUSE00000657951 Chr17:27156759..27157980 ACCATGCAATGTTGGGGTAT Chr17:27157663..27157682 59.94 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCCCACATCTGGAGCAGAG Chr17:27165362..27165382 60.22 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCCCACATCTGGAGCAGAG Chr17:27165362..27165382 60.22 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGAGCTGGGACCTCCTCTAT Chr17:27165543..27165563 59.66 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGAGCTGGGACCTCCTCTAT Chr17:27165543..27165563 59.66 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000057789