Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19984
Trapped Gene
Ttc39b (ENSMUSG00000038172)
Vector Insertion
Chr 4: 82909706 - 82917020
Public Clones (sanger) (sanger) (sanger) D137A05 (ggtc) CMHD-GT_545F1-3 (cmhd) CMHD-GT_476D8-3 (cmhd)
IST12298B11 (tigm) IST12298B11 (tigm) IST13285F4 (tigm) IST11625C12 (tigm)
IST13052B10 (tigm)
Private Clones OST375873 (lexicon) OST256557 (lexicon) OST248065 (lexicon) OST217238 (lexicon)
OST105050 (lexicon) OST65674 (lexicon) OST54244 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662713 (Chr4:82917021..82917122 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGTACCATGCGAGACCAAA Chr4:82917068..82917087 60.11 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662713 (Chr4:82917021..82917122 -)
Downstram Exon
ENSMUSE00000316901 (Chr4:82909598..82909705 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGTACCATGCGAGACCAAA Chr4:82917068..82917087 60.11 45 AGTGCCTCTGCACACTCCTC Chr4:82909630..82909649 60.62 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662715 Chr4:82969975..82970143 CCAGAGCCAGAAAAGAGTCG Chr4:82970060..82970079 60.13 55
upstream ENSMUSE00000672451 Chr4:82969975..82970093 CCAGAGCCAGAAAAGAGTCG Chr4:82970060..82970079 60.13 55
upstream ENSMUSE00000662714 Chr4:82943832..82943866 AAGATGCCTTGGAGACCATC Chr4:82943837..82943856 59.09 50
upstream ENSMUSE00000662713 Chr4:82917021..82917122 TTGTACCATGCGAGACCAAA Chr4:82917068..82917087 60.11 45

*** Putative Vector Insertion (Chr 4: 82909706 - 82917020) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000316901 Chr4:82909598..82909705 AGTGCCTCTGCACACTCCTC Chr4:82909630..82909649 60.62 60
downstream ENSMUSE00000179608 Chr4:82907730..82907861 AAGGCGTGGTACATGCTCTC Chr4:82907813..82907832 60.28 55
downstream ENSMUSE00000179611 Chr4:82906786..82906862 GGACCCTCGAGAAAGGAGAC Chr4:82906783..82906802 60.19 60
downstream ENSMUSE00000632112 Chr4:82905237..82905370 CATACTGGGGCCAGTTCAGT Chr4:82905253..82905272 59.99 55
downstream ENSMUSE00000410757 Chr4:82901949..82902016 GCACAAATGTGAGTGCTGCT Chr4:82901929..82901948 60.06 50
downstream ENSMUSE00000317041 Chr4:82898890..82898954 No primer for this exon
downstream ENSMUSE00000317029 Chr4:82893517..82893622 CGTTCCAAGCTTGACTCCTC Chr4:82893510..82893529 59.99 55
downstream ENSMUSE00000340971 Chr4:82892177..82892242 CCGGATGATTCTTGCTGGTA Chr4:82892188..82892207 60.99 50
downstream ENSMUSE00000430273 Chr4:82890934..82891042 TATGGAAGGCCAGGATGGTA Chr4:82890933..82890952 60.29 50
downstream ENSMUSE00000430267 Chr4:82889952..82890019 TGGGAACTGTTGAAGGAACG Chr4:82889933..82889952 61.06 50
downstream ENSMUSE00000430264 Chr4:82889808..82889867 CGATTCGGGCATGATAGAAG Chr4:82889812..82889831 60.56 50
downstream ENSMUSE00000405941 Chr4:82888043..82888204 AATACGCCTGCATCCAATTT Chr4:82888062..82888081 59.44 40
downstream ENSMUSE00000333965 Chr4:82887550..82887641 CCTTAGTCGCTGCCACTTCT Chr4:82887550..82887569 59.64 55
downstream ENSMUSE00000317124 Chr4:82885972..82886098 GCGATTCTCTGCTTCAGACC Chr4:82886047..82886066 60.1 55
downstream ENSMUSE00000672446 Chr4:82885714..82886098 GCGATTCTCTGCTTCAGACC Chr4:82886047..82886066 60.1 55
downstream ENSMUSE00000317119 Chr4:82883146..82883254 ATTCTGCAATGCCTCCTCAG Chr4:82883128..82883147 60.36 50
downstream ENSMUSE00000317110 Chr4:82878615..82878732 CAACGTGGTTGAAACACAGC Chr4:82878600..82878619 60.2 50
downstream ENSMUSE00000317104 Chr4:82876312..82876428 TGCCAACTCAAACAGCGTAA Chr4:82876349..82876368 60.44 45
downstream ENSMUSE00000662712 Chr4:82866205..82873128 AAACAAGCCACGGAGCTCTA Chr4:82869193..82869212 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTGCTCTTCCTTGGTCTGC Chr4:82914030..82914050 60 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTGCTCTTCCTTGGTCTGC Chr4:82914030..82914050 60 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCAACAGCCTTTTTGGAGTC Chr4:82911105..82911125 59.86 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTCCACGTGACTGGGAAAAC Chr4:82911057..82911077 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038172