Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI19990
Trapped Gene
Mrps18a (ENSMUSG00000023967)
Vector Insertion
Chr 17: 46262662 - 46265453
Public Clones E048F06 (ggtc) E048F06 (ggtc)
Private Clones OST375748 (lexicon)
Severity of mutation (?) Insertion after 76% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000136718 (Chr17:46262592..46262661 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCACAGACCACAGCTTCCA Chr17:46262604..46262623 59.26 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000136718 (Chr17:46262592..46262661 +)
Downstram Exon
ENSMUSE00000385620 (Chr17:46265454..46265854 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCACAGACCACAGCTTCCA Chr17:46262604..46262623 59.26 50 TAGATGGGCTTGACGGACTT Chr17:46265498..46265517 59.69 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000414126 Chr17:46247965..46248078 CTGGTTATGGCTTCCAGCTC Chr17:46248044..46248063 59.84 55
upstream ENSMUSE00000136715 Chr17:46254889..46254920 CCAAGAAGGGAAGACGACTG Chr17:46254899..46254918 59.84 55
upstream ENSMUSE00000136717 Chr17:46259673..46259780 GACTCCAGATCCCCCTAACC Chr17:46259705..46259724 59.76 60
upstream ENSMUSE00000136716 Chr17:46262239..46262362 GAACACCGAAAAATCGAGGA Chr17:46262317..46262336 60.05 45
upstream ENSMUSE00000136718 Chr17:46262592..46262661 ATCACAGACCACAGCTTCCA Chr17:46262604..46262623 59.26 50

*** Putative Vector Insertion (Chr 17: 46262662 - 46265453) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000385620 Chr17:46265454..46265854 TAGATGGGCTTGACGGACTT Chr17:46265498..46265517 59.69 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAGCTTTTCAGGGCCTATG Chr17:46262689..46262709 59.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAGCTTTTCAGGGCCTATG Chr17:46262689..46262709 59.84 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023967