Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20007
Trapped Gene
Kifc3 (ENSMUSG00000031788)
Vector Insertion
Chr 8: 97634660 - 97658616
Public Clones IST10765C6 (tigm)
Private Clones OST375190 (lexicon)
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000509682 (Chr8:97658617..97658759 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACTCCACTTCTCGGACTGC Chr8:97658705..97658724 59.99 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000509682 (Chr8:97658617..97658759 -)
Downstram Exon
ENSMUSE00000478013 (Chr8:97634594..97634659 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACTCCACTTCTCGGACTGC Chr8:97658705..97658724 59.99 60 GGCCTGGCTAATGAGCTTTT Chr8:97634602..97634621 60.71 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000680554 Chr8:97666332..97666449 GGGATCCTGTCTCCGCTAGG Chr8:97666335..97666354 63.32 65
upstream ENSMUSE00000634996 Chr8:97661815..97662019 No primer for this exon
upstream ENSMUSE00000509682 Chr8:97658617..97658759 GACTCCACTTCTCGGACTGC Chr8:97658705..97658724 59.99 60

*** Putative Vector Insertion (Chr 8: 97634660 - 97658616) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000478013 Chr8:97634594..97634659 GGCCTGGCTAATGAGCTTTT Chr8:97634602..97634621 60.71 50
downstream ENSMUSE00000503154 Chr8:97634030..97634173 TGCTCATTCTCCACCATCAG Chr8:97634099..97634118 59.79 50
downstream ENSMUSE00000212999 Chr8:97633684..97633923 GGCGATAGTCTCATGGCTGT Chr8:97633692..97633711 60.25 55
downstream ENSMUSE00000212992 Chr8:97633082..97633255 GCTGGTGGGAGTTCTGTAGC Chr8:97633083..97633102 59.87 60
downstream ENSMUSE00000212987 Chr8:97632475..97632622 TCCTCCAAGGACTGCATCTC Chr8:97632530..97632549 60.35 55
downstream ENSMUSE00000212997 Chr8:97632255..97632385 TGAGCCCATTGTAGTCGTTG Chr8:97632295..97632314 59.72 50
downstream ENSMUSE00000213002 Chr8:97631324..97631435 GACCAGCTCGTTATGGCATT Chr8:97631312..97631331 60.1 50
downstream ENSMUSE00000212993 Chr8:97630363..97630544 AGCAGGTGGATGATGGAGTC Chr8:97630408..97630427 60.08 55
downstream ENSMUSE00000212991 Chr8:97629620..97629724 CCATCGATGCAGGAGGTAAT Chr8:97629659..97629678 59.92 50
downstream ENSMUSE00000212998 Chr8:97627795..97627925 CTGACGGTGATGTTGTACTGC Chr8:97627803..97627823 59.23 52.38
downstream ENSMUSE00000212988 Chr8:97627311..97627434 CACAGTCGGATCTCCAGCTT Chr8:97627365..97627384 60.41 55
downstream ENSMUSE00000212996 Chr8:97626563..97626692 TGTTCGTTCAGGTTGGTGAA Chr8:97626615..97626634 60.13 45
downstream ENSMUSE00000212990 Chr8:97626247..97626476 GGTCTTGCTGTCACCACTGA Chr8:97626240..97626259 59.87 55
downstream ENSMUSE00000212986 Chr8:97625912..97626046 CGCTGGTGTTCTTCTCCACT Chr8:97625997..97626016 60.44 55
downstream ENSMUSE00000212995 Chr8:97625309..97625417 AGAGTGGGCTCGTGCTGTAG Chr8:97625348..97625367 60.61 60
downstream ENSMUSE00000680544 Chr8:97624547..97624573 No primer for this exon
downstream ENSMUSE00000680543 Chr8:97623733..97624352 GGATTTGGGGAGAGGAACAT Chr8:97623769..97623788 60.13 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTGACAGCAGGCTCTACCT Chr8:97634571..97634591 59.62 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTGACAGCAGGCTCTACCT Chr8:97634571..97634591 59.62 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ACTTCTCGTAATCGCCTTGC Chr8:97634697..97634717 59.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGGTACCTTGCTCGTGACTG Chr8:97634701..97634721 59.9 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031788