Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20019
Trapped Gene
Elavl1 (ENSMUSG00000040028)
Vector Insertion
Chr 8: 4311787 - 4312556
Public Clones PST20586-NR (escells)
Private Clones OST374929 (lexicon) OST289872 (lexicon) OST177149 (lexicon) OST171453 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000706645 (Chr8:4312557..4312614 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000706645 (Chr8:4312557..4312614 -)
Downstram Exon
ENSMUSE00000229444 (Chr8:4311599..4311786 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CCCGAATAAGCTTTGCAGAT Chr8:4311589..4311608 59.32 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000638320 Chr8:4324886..4325086 No primer for this exon
upstream ENSMUSE00000706646 Chr8:4324886..4324906 No primer for this exon
upstream ENSMUSE00000706645 Chr8:4312557..4312614 No primer for this exon

*** Putative Vector Insertion (Chr 8: 4311787 - 4312556) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000229444 Chr8:4311599..4311786 CCCGAATAAGCTTTGCAGAT Chr8:4311589..4311608 59.32 45
downstream ENSMUSE00000229435 Chr8:4304927..4305030 GTCTCAAGCCGTTCAGTGTG Chr8:4304925..4304944 59.47 55
downstream ENSMUSE00000229429 Chr8:4301685..4301838 AGTTGATGATTCGCCCAAAC Chr8:4301690..4301709 59.94 45
downstream ENSMUSE00000278547 Chr8:4295336..4295561 CTGCTTCTGACCGTTTGTCA Chr8:4295489..4295508 60.03 50
downstream ENSMUSE00000638319 Chr8:4288347..4289924 ACAGAACCCCAAACGTCAAG Chr8:4288409..4288428 60.01 50
downstream ENSMUSE00000706644 Chr8:4288344..4289924 ACAGAACCCCAAACGTCAAG Chr8:4288409..4288428 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr8:4312486..4312506 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TATGGGTGGGTGCATGTGTA Chr8:4312509..4312529 60.67 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATAATCGCCTTGCAGCACAT Chr8:4312545..4312565 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTGTACGTGACTGGGAAAACC Chr8:4312548..4312569 59.88 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040028