Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20034
Trapped Gene
Jmjd2c (ENSMUSG00000028397)
Vector Insertion
Chr 4: 73917274 - 73926800
Public Clones not available
Private Clones OST374616 (lexicon) OST346156 (lexicon) OST244722 (lexicon) OST244560 (lexicon)
OST234120 (lexicon) OST224850 (lexicon) OST212523 (lexicon) OST197731 (lexicon)
OST105705 (lexicon)
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000330084 (Chr4:73917098..73917273 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCACCAATTCAGCAGATG Chr4:73917162..73917181 60.41 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000330084 (Chr4:73917098..73917273 +)
Downstram Exon
ENSMUSE00000330076 (Chr4:73926801..73926915 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCACCAATTCAGCAGATG Chr4:73917162..73917181 60.41 50 TTTCCAGTATTTGCGTTCCA Chr4:73926858..73926877 59.16 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000486245 Chr4:73888401..73888544 No primer for this exon
upstream ENSMUSE00000399503 Chr4:73897783..73897990 GCGGAACAAGTCTTCCAAAG Chr4:73897892..73897911 59.85 50
upstream ENSMUSE00000632197 Chr4:73908713..73908873 GGAGTTTCGGGAGTTCAACA Chr4:73908801..73908820 60.09 50
upstream ENSMUSE00000710008 Chr4:73908713..73908873 GGAGTTTCGGGAGTTCAACA Chr4:73908801..73908820 60.09 50
upstream ENSMUSE00000330084 Chr4:73917098..73917273 CAGCACCAATTCAGCAGATG Chr4:73917162..73917181 60.41 50

*** Putative Vector Insertion (Chr 4: 73917274 - 73926800) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000330076 Chr4:73926801..73926915 TTTCCAGTATTTGCGTTCCA Chr4:73926858..73926877 59.16 40
downstream ENSMUSE00000662754 Chr4:73944345..73944538 GAGATCCATGTCCTCCGTGT Chr4:73944500..73944519 59.93 55
downstream ENSMUSE00000178776 Chr4:73952869..73952918 TTTCAAGTCGCTTTCCATGC Chr4:73952909..73952928 61.28 45
downstream ENSMUSE00000330062 Chr4:73957551..73957654 GGGAGCTACTGGGGAAGAAG Chr4:73957574..73957593 60.2 60
downstream ENSMUSE00000178777 Chr4:73961416..73961553 GCAACCTTGCCGTAGTCAAT Chr4:73961549..73961568 60.14 50
downstream ENSMUSE00000178785 Chr4:73976559..73976752 CATGTCATTCCGACAAGTGC Chr4:73976582..73976601 60.12 50
downstream ENSMUSE00000716477 Chr4:73979537..73979772 CCCCAGCTTTAATGCTTTTTC Chr4:73979689..73979709 60.08 42.86
downstream ENSMUSE00000716571 Chr4:73979537..73979772 CCCCAGCTTTAATGCTTTTTC Chr4:73979689..73979709 60.08 42.86
downstream ENSMUSE00000330040 Chr4:73980453..73980772 GATGGCCATGAGAAAGTGGT Chr4:73980581..73980600 59.93 50
downstream ENSMUSE00000672664 Chr4:73980453..73980772 GATGGCCATGAGAAAGTGGT Chr4:73980581..73980600 59.93 50
downstream ENSMUSE00000330032 Chr4:73982786..73982894 ATCACTCGCTACCTGCTGCT Chr4:73982893..73982912 60.19 55
downstream ENSMUSE00000672661 Chr4:73982786..73982894 ATCACTCGCTACCTGCTGCT Chr4:73982893..73982912 60.19 55
downstream ENSMUSE00000178774 Chr4:73989274..73989455 CAGAGTGCAGATGGCACAGT Chr4:73989440..73989459 60.06 55
downstream ENSMUSE00000672658 Chr4:73989274..73989455 CAGAGTGCAGATGGCACAGT Chr4:73989440..73989459 60.06 55
downstream ENSMUSE00000178775 Chr4:73991347..73991560 TCTTCAAGGAAGGCATTTGG Chr4:73991507..73991526 60.18 45
downstream ENSMUSE00000672656 Chr4:73991347..73991560 TCTTCAAGGAAGGCATTTGG Chr4:73991507..73991526 60.18 45
downstream ENSMUSE00000178784 Chr4:73994304..73994380 CACAGCCATCCATCACAGAC Chr4:73994352..73994371 60.12 55
downstream ENSMUSE00000672654 Chr4:73994304..73994380 CACAGCCATCCATCACAGAC Chr4:73994352..73994371 60.12 55
downstream ENSMUSE00000178788 Chr4:74003246..74003301 TCCCCTCAAATTGCAGAGAC Chr4:74003275..74003294 60.19 50
downstream ENSMUSE00000672652 Chr4:74003246..74003301 TCCCCTCAAATTGCAGAGAC Chr4:74003275..74003294 60.19 50
downstream ENSMUSE00000178782 Chr4:74005324..74005432 CTGGAACTGCAACAGCACAT Chr4:74005361..74005380 59.9 50
downstream ENSMUSE00000672651 Chr4:74005324..74005432 CTGGAACTGCAACAGCACAT Chr4:74005361..74005380 59.9 50
downstream ENSMUSE00000178783 Chr4:74019470..74019655 ACCACGTAAGGCCAGTCATC Chr4:74019618..74019637 60 55
downstream ENSMUSE00000672650 Chr4:74019470..74019655 ACCACGTAAGGCCAGTCATC Chr4:74019618..74019637 60 55
downstream ENSMUSE00000178787 Chr4:74023534..74023704 CCGAGTGTTTCGATGTTTTG Chr4:74023605..74023624 59.17 45
downstream ENSMUSE00000672649 Chr4:74023534..74023704 CCGAGTGTTTCGATGTTTTG Chr4:74023605..74023624 59.17 45
downstream ENSMUSE00000178779 Chr4:74037281..74037400 GGCCATTTGACTTGGATGAC Chr4:74037345..74037364 60.33 50
downstream ENSMUSE00000672648 Chr4:74037281..74037400 GGCCATTTGACTTGGATGAC Chr4:74037345..74037364 60.33 50
downstream ENSMUSE00000329972 Chr4:74045251..74045343 CAATCTGCGATCCATCTTCA Chr4:74045281..74045300 59.76 45
downstream ENSMUSE00000672646 Chr4:74045251..74045343 CAATCTGCGATCCATCTTCA Chr4:74045281..74045300 59.76 45
downstream ENSMUSE00000445447 Chr4:74050725..74051765 GTCCCAATGTGTACCCCAAG Chr4:74050985..74051004 60.09 55
downstream ENSMUSE00000662753 Chr4:74050725..74051764 GTCCCAATGTGTACCCCAAG Chr4:74050985..74051004 60.09 55
downstream ENSMUSE00000672645 Chr4:74050725..74051765 GTCCCAATGTGTACCCCAAG Chr4:74050985..74051004 60.09 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTTCTGTGCTGGCAAGAGG Chr4:73926255..73926275 60.4 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGTCGTGACTGGGAAAAC Chr4:73926320..73926340 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028397