Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20047
Trapped Gene
Nus1 (ENSMUSG00000023068)
Vector Insertion
Chr 10: 52137975 - 52148998
Public Clones not available
Private Clones OST374337 (lexicon) OST350779 (lexicon) OST318411 (lexicon) OST128580 (lexicon)
Severity of mutation (?) Insertion after 48% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000411272 (Chr10:52137365..52137974 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGTTGGTCACGGAGGAAGT Chr10:52137866..52137885 60.15 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000411272 (Chr10:52137365..52137974 +)
Downstram Exon
ENSMUSE00000302205 (Chr10:52148999..52149124 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGTTGGTCACGGAGGAAGT Chr10:52137866..52137885 60.15 55 CTTGGCCCAAAAGTTCCTGT Chr10:52149073..52149092 61.4 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000411272 Chr10:52137365..52137974 CTGTTGGTCACGGAGGAAGT Chr10:52137866..52137885 60.15 55

*** Putative Vector Insertion (Chr 10: 52137975 - 52148998) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000302205 Chr10:52148999..52149124 CTTGGCCCAAAAGTTCCTGT Chr10:52149073..52149092 61.4 50
downstream ENSMUSE00000133320 Chr10:52149873..52150022 GCTGCTGGGCTACTAACTGG Chr10:52149977..52149996 60.04 60
downstream ENSMUSE00000133319 Chr10:52153151..52153250 CTGATTTGCCAGGGAAGAAA Chr10:52153238..52153257 60.18 45
downstream ENSMUSE00000362324 Chr10:52156383..52156570 GGCGGAGAAGAAGTCCTCAT Chr10:52156434..52156453 60.74 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTTGGGAAATCAGGCCTTT Chr10:52146955..52146975 60.42 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGAGTCTGAGGACGTGACTG Chr10:52147014..52147034 59.6 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023068