Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2005
Trapped Gene
Srprb (ENSMUSG00000032553)
Vector Insertion
Chr 9: 103094680 - 103099867
Public Clones BA0069 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 50% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000220707 (Chr9:103099868..103099950 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCTGACTCTGATCGACCTC Chr9:103099924..103099943 59.95 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000220707 (Chr9:103099868..103099950 -)
Downstram Exon
ENSMUSE00000320245 (Chr9:103094543..103094679 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCTGACTCTGATCGACCTC Chr9:103099924..103099943 59.95 60 AATTCGGCCACATCTTTCAC Chr9:103094595..103094614 59.94 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000398828 Chr9:103104242..103104437 CCAGCCTTACCTCGACTCCT Chr9:103104320..103104339 60.78 60
upstream ENSMUSE00000220699 Chr9:103103617..103103711 GGGAAAACGTTGCTGTTTGT Chr9:103103621..103103640 60.01 45
upstream ENSMUSE00000220705 Chr9:103101119..103101196 TGGCCAGTACAGAGACACACA Chr9:103101168..103101188 60.36 52.38
upstream ENSMUSE00000220707 Chr9:103099868..103099950 GCCTGACTCTGATCGACCTC Chr9:103099924..103099943 59.95 60

*** Putative Vector Insertion (Chr 9: 103094680 - 103099867) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000320245 Chr9:103094543..103094679 AATTCGGCCACATCTTTCAC Chr9:103094595..103094614 59.94 45
downstream ENSMUSE00000220708 Chr9:103093399..103093453 ACTTCGCTGATTTTGCCATT Chr9:103093405..103093424 59.71 40
downstream ENSMUSE00000396391 Chr9:103091420..103092751 CCCTACTCTCAAAGCGATGC Chr9:103092243..103092262 59.98 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAGTCTGCACTGCGTCCTA Chr9:103096814..103096834 60.2 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAGGGATGAAGTGACATGG Chr9:103096841..103096861 59.47 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032553