Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20060
Trapped Gene
Slc30a6 (ENSMUSG00000024069)
Vector Insertion
Chr 17: 74806627 - 74808185
Public Clones not available
Private Clones OST374099 (lexicon)
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000413190 (Chr17:74806561..74806626 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAGGAAACCTAGCCCTGTCT Chr17:74806596..74806616 60.25 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000413190 (Chr17:74806561..74806626 +)
Downstram Exon
ENSMUSE00000367165 (Chr17:74808186..74808266 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAGGAAACCTAGCCCTGTCT Chr17:74806596..74806616 60.25 52.38 CCCAATTGTGCCAAGACAGT Chr17:74808245..74808264 60.95 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000692249 Chr17:74794972..74795008 GCTGTACGGCTCCTTACCAT Chr17:74794988..74795007 59.22 55
upstream ENSMUSE00000383604 Chr17:74801252..74801338 TAGACTTGTCGCAGCTGACC Chr17:74801314..74801333 59.19 55
upstream ENSMUSE00000394914 Chr17:74803344..74803428 CTTCTGTTCGGTGCAATCAA Chr17:74803356..74803375 59.84 45
upstream ENSMUSE00000369221 Chr17:74805025..74805067 No primer for this exon
upstream ENSMUSE00000413190 Chr17:74806561..74806626 TGAGGAAACCTAGCCCTGTCT Chr17:74806596..74806616 60.25 52.38

*** Putative Vector Insertion (Chr 17: 74806627 - 74808185) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000367165 Chr17:74808186..74808266 CCCAATTGTGCCAAGACAGT Chr17:74808245..74808264 60.95 50
downstream ENSMUSE00000338492 Chr17:74808693..74808728 No primer for this exon
downstream ENSMUSE00000375948 Chr17:74809674..74809768 GCATCGTGAACAGGTTGAAA Chr17:74809732..74809751 59.7 45
downstream ENSMUSE00000335967 Chr17:74811614..74811662 TCCTGAAGCCAGCTCGTACT Chr17:74811641..74811660 60.16 55
downstream ENSMUSE00000137945 Chr17:74811947..74812066 CTGGGATAAGGCCACACAAG Chr17:74811969..74811988 60.51 55
downstream ENSMUSE00000137950 Chr17:74814960..74815062 TACATGGTGCCAAACGTCAT Chr17:74815028..74815047 59.85 45
downstream ENSMUSE00000137948 Chr17:74817960..74818007 No primer for this exon
downstream ENSMUSE00000137946 Chr17:74818872..74818940 CTAGCACCCCATCCAAGGTA Chr17:74818899..74818918 59.95 55
downstream ENSMUSE00000656979 Chr17:74822357..74823569 AAGGACCATTTGTTCGTTCG Chr17:74822413..74822432 59.97 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATTAATCGCCTTGCAGCAC Chr17:74806675..74806695 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000024069