Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20062
Trapped Gene
Vangl1 (ENSMUSG00000027860)
Vector Insertion
Chr 3: 101967457 - 101969277
Public Clones (cmhd) CMHD-GT_236E4-3 (cmhd) IST12285C6 (tigm) IST11597C9 (tigm)
Private Clones OST374078 (lexicon) OST177904 (lexicon) OST172237 (lexicon)
Severity of mutation (?) Insertion after 69% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000173686 (Chr3:101969278..101969410 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATAACGCCACTGGTCAGTCC Chr3:101969382..101969401 60 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000173686 (Chr3:101969278..101969410 -)
Downstram Exon
ENSMUSE00000173682 (Chr3:101967222..101967456 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATAACGCCACTGGTCAGTCC Chr3:101969382..101969401 60 55 CATGCTGTGGTAGTGCTGCT Chr3:101967254..101967273 60.08 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000453892 Chr3:102008435..102008531 No primer for this exon
upstream ENSMUSE00000453884 Chr3:102000715..102000899 ATCAGACGAAGCTTGCCATT Chr3:102000789..102000808 59.84 45
upstream ENSMUSE00000453879 Chr3:101993332..101993470 AGATGGCAGAGGGTCAGAAA Chr3:101993412..101993431 59.8 50
upstream ENSMUSE00000453875 Chr3:101987874..101988481 CATCGTGCAATACGCAGTCT Chr3:101988013..101988032 59.9 50
upstream ENSMUSE00000370676 Chr3:101970761..101970894 CGAACCTCCTAACAGCATCC Chr3:101970813..101970832 59.69 55
upstream ENSMUSE00000173686 Chr3:101969278..101969410 ATAACGCCACTGGTCAGTCC Chr3:101969382..101969401 60 55

*** Putative Vector Insertion (Chr 3: 101967457 - 101969277) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000173682 Chr3:101967222..101967456 CATGCTGTGGTAGTGCTGCT Chr3:101967254..101967273 60.08 55
downstream ENSMUSE00000396395 Chr3:101962119..101962420 GAGCCATCGATCCTTGTCAT Chr3:101962336..101962355 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGTCTGTGACCCTTGCAC Chr3:101969259..101969279 60.16 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGTCTGTGACCCTTGCAC Chr3:101969259..101969279 60.16 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTAATCGCCTTGCAGCACAT Chr3:101969341..101969361 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AATAACGCCACTGGTCAGTCC Chr3:101969380..101969401 61.31 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027860