Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20073
Trapped Gene
Cdadc1 (ENSMUSG00000021982)
Vector Insertion
Chr 14: 60208803 - 60211297
Public Clones not available
Private Clones OST373729 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000122677 (Chr14:60211298..60211372 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGAAGAGGAAAGCCGTGGT Chr14:60211349..60211368 61.71 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000122677 (Chr14:60211298..60211372 -)
Downstram Exon
ENSMUSE00000401738 (Chr14:60208625..60208802 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGAAGAGGAAAGCCGTGGT Chr14:60211349..60211368 61.71 55 ATGAGAGCAATTTGCCCAGT Chr14:60208686..60208705 59.7 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000714868 Chr14:60216592..60216781 GGAACCTATCATGCCTGACC Chr14:60216711..60216730 59.37 55
upstream ENSMUSE00000722335 Chr14:60216592..60216781 GGAACCTATCATGCCTGACC Chr14:60216711..60216730 59.37 55
upstream ENSMUSE00000395067 Chr14:60215699..60215796 TGAACCTTTTCACCCTGCTC Chr14:60215753..60215772 60.23 50
upstream ENSMUSE00000407634 Chr14:60215699..60215796 TGAACCTTTTCACCCTGCTC Chr14:60215753..60215772 60.23 50
upstream ENSMUSE00000122677 Chr14:60211298..60211372 CTGAAGAGGAAAGCCGTGGT Chr14:60211349..60211368 61.71 55
upstream ENSMUSE00000358391 Chr14:60211298..60211372 CTGAAGAGGAAAGCCGTGGT Chr14:60211349..60211368 61.71 55

*** Putative Vector Insertion (Chr 14: 60208803 - 60211297) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000122683 Chr14:60208625..60208802 ATGAGAGCAATTTGCCCAGT Chr14:60208686..60208705 59.7 45
downstream ENSMUSE00000401738 Chr14:60208625..60208802 ATGAGAGCAATTTGCCCAGT Chr14:60208686..60208705 59.7 45
downstream ENSMUSE00000122673 Chr14:60204876..60205445 TTCAATCTTTCTGCGGCTTT Chr14:60205312..60205331 59.96 40
downstream ENSMUSE00000283946 Chr14:60200162..60200211 CCCAAATGACAGCTCCAACT Chr14:60200154..60200173 60.11 50
downstream ENSMUSE00000283938 Chr14:60194571..60194740 GTTCTGCTCCGCATGTATGA Chr14:60194563..60194582 59.83 50
downstream ENSMUSE00000122679 Chr14:60192484..60192673 AATTTGCGAACACCCTCAAG Chr14:60192466..60192485 60.11 45
downstream ENSMUSE00000397753 Chr14:60187785..60187845 CTCCTTTCAGGCTCATTTGG Chr14:60187768..60187787 59.81 50
downstream ENSMUSE00000122675 Chr14:60186847..60186875 No primer for this exon
downstream ENSMUSE00000648282 Chr14:60182813..60183432 GATCGCCTCCTGTGAATGAT Chr14:60183074..60183093 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr14:60211227..60211247 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTTACGTGACTGGGAAAACC Chr14:60211230..60211251 58.47 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021982