Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20080
Trapped Gene
Jup (ENSMUSG00000001552)
Vector Insertion
Chr 11: 100258949 - 100259064
Public Clones not available
Private Clones OST373561 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000673005 (Chr11:100258950..100259077 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000673005 (Chr11:100258950..100259077 -)
Downstram Exon
ENSMUSE00000337989 (Chr11:100258935..100259063 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000673005 Chr11:100258950..100259077 No primer for this exon

*** Putative Vector Insertion (Chr 11: 100258949 - 100259064) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000337989 Chr11:100258935..100259063 No primer for this exon
downstream ENSMUSE00000383613 Chr11:100247487..100247702 No primer for this exon
downstream ENSMUSE00000673003 Chr11:100247487..100247699 No primer for this exon
downstream ENSMUSE00000336301 Chr11:100244709..100244968 No primer for this exon
downstream ENSMUSE00000112636 Chr11:100244321..100244559 No primer for this exon
downstream ENSMUSE00000112631 Chr11:100242990..100243191 No primer for this exon
downstream ENSMUSE00000577245 Chr11:100241858..100242002 No primer for this exon
downstream ENSMUSE00000112641 Chr11:100240836..100240939 No primer for this exon
downstream ENSMUSE00000112635 Chr11:100239403..100239741 No primer for this exon
downstream ENSMUSE00000112639 Chr11:100238037..100238312 No primer for this exon
downstream ENSMUSE00000112640 Chr11:100235640..100235790 No primer for this exon
downstream ENSMUSE00000112638 Chr11:100235392..100235513 No primer for this exon
downstream ENSMUSE00000112642 Chr11:100233970..100234009 No primer for this exon
downstream ENSMUSE00000400222 Chr11:100233610..100233775 No primer for this exon
downstream ENSMUSE00000360024 Chr11:100231935..100232763 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCGAGCTCAGTTCGCTTAAT Chr11:100259009..100259029 59.62 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTACTGAGTTGCTGCCTTGG Chr11:100259061..100259081 59.07 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001552