Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20083
Trapped Gene
3300001P08Rik (ENSMUSG00000020863)
Vector Insertion
Chr 11: 94162894 - 94165155
Public Clones not available
Private Clones OST373438 (lexicon) OST277657 (lexicon)
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000110623 (Chr11:94165156..94165300 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000110623 (Chr11:94165156..94165300 -)
Downstram Exon
ENSMUSE00000110627 (Chr11:94162819..94162893 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000381021 Chr11:94183004..94183225 No primer for this exon
upstream ENSMUSE00000674525 Chr11:94183004..94183302 No primer for this exon
upstream ENSMUSE00000110620 Chr11:94170939..94171005 No primer for this exon
upstream ENSMUSE00000110618 Chr11:94167500..94167539 No primer for this exon
upstream ENSMUSE00000110623 Chr11:94165156..94165300 No primer for this exon

*** Putative Vector Insertion (Chr 11: 94162894 - 94165155) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000110627 Chr11:94162819..94162893 No primer for this exon
downstream ENSMUSE00000110625 Chr11:94161270..94161374 No primer for this exon
downstream ENSMUSE00000110624 Chr11:94159073..94159234 No primer for this exon
downstream ENSMUSE00000110621 Chr11:94158198..94158481 No primer for this exon
downstream ENSMUSE00000110626 Chr11:94157234..94157394 No primer for this exon
downstream ENSMUSE00000110628 Chr11:94154452..94154592 No primer for this exon
downstream ENSMUSE00000674524 Chr11:94154399..94154592 No primer for this exon
downstream ENSMUSE00000674529 Chr11:94154241..94154346 No primer for this exon
downstream ENSMUSE00000674528 Chr11:94152844..94152892 No primer for this exon
downstream ENSMUSE00000365413 Chr11:94152454..94154346 No primer for this exon
downstream ENSMUSE00000674521 Chr11:94152453..94154592 No primer for this exon
downstream ENSMUSE00000674523 Chr11:94152453..94152892 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCATGCTCGTTTGGCATTA Chr11:94165178..94165198 59.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCATGCTCGTTTGGCATTA Chr11:94165178..94165198 59.69 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020863