Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20096
Trapped Gene
Hist1h2bp (ENSMUSG00000069308)
Vector Insertion
Chr 13: 21880892 - 21880953
Public Clones not available
Private Clones OST373023 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000684051 (Chr13:21880893..21881079 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAGTGGAGACCGAAGTGTG Chr13:21880988..21881007 59.86 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000684051 (Chr13:21880893..21881079 +)
Downstram Exon
ENSMUSE00000571614 (Chr13:21880893..21880952 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAGTGGAGACCGAAGTGTG Chr13:21880988..21881007 59.86 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000684052 Chr13:21879357..21879760 TCGTGAACGACATCTTCGAG Chr13:21879580..21879599 59.98 50
upstream ENSMUSE00000660932 Chr13:21879377..21879845 TCGTGAACGACATCTTCGAG Chr13:21879580..21879599 59.98 50
upstream ENSMUSE00000571615 Chr13:21879384..21879668 TCGTGAACGACATCTTCGAG Chr13:21879580..21879599 59.98 50
upstream ENSMUSE00000643298 Chr13:21879671..21879760 GGCTGTCACCAAGTACACCA Chr13:21879734..21879753 59.6 55

*** Putative Vector Insertion (Chr 13: 21880892 - 21880953) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000571614 Chr13:21880893..21880952 No primer for this exon
downstream ENSMUSE00000684051 Chr13:21880893..21881079 CACACTTCGGTCTCCACTCA Chr13:21881010..21881029 59.86 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr13:21880943..21880963 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGGACGTGACTGGGAAAA Chr13:21880937..21880957 61.64 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000069308