Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20104
Trapped Gene
Ttll1 (ENSMUSG00000022442)
Vector Insertion
Chr 15: 83320063 - 83322303
Public Clones not available
Private Clones OST372941 (lexicon)
Severity of mutation (?) Insertion after 77% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000680490 (Chr15:83322304..83323055 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTGTAGTGGTGGCTGACCT Chr15:83322830..83322849 60.03 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000680490 (Chr15:83322304..83323055 -)
Downstram Exon
ENSMUSE00000247472 (Chr15:83319899..83320062 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTGTAGTGGTGGCTGACCT Chr15:83322830..83322849 60.03 60 GGGAGACTTGTTCCACTTGC Chr15:83319909..83319928 59.7 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000126846 Chr15:83341164..83341323 CTGCTACCCAGTCCGTGTCT Chr15:83341263..83341282 60.32 60
upstream ENSMUSE00000680491 Chr15:83341164..83341304 CTGCTACCCAGTCCGTGTCT Chr15:83341263..83341282 60.32 60
upstream ENSMUSE00000680495 Chr15:83341164..83341311 CTGCTACCCAGTCCGTGTCT Chr15:83341263..83341282 60.32 60
upstream ENSMUSE00000126838 Chr15:83336710..83336757 No primer for this exon
upstream ENSMUSE00000680494 Chr15:83336115..83336162 CTCGTGCCTCTTCTGTGGTT Chr15:83336141..83336160 60.44 55
upstream ENSMUSE00000126826 Chr15:83335913..83336073 CCTGATCCTCCGCCATACTA Chr15:83335995..83336014 60.05 55
upstream ENSMUSE00000126841 Chr15:83335680..83335796 GAGAGGGTGGATCCAAGTGA Chr15:83335708..83335727 60.05 55
upstream ENSMUSE00000722219 Chr15:83335680..83335796 GAGAGGGTGGATCCAAGTGA Chr15:83335708..83335727 60.05 55
upstream ENSMUSE00000126845 Chr15:83332511..83332719 CCAGATCGTCAACCATTTCC Chr15:83332637..83332656 60.32 50
upstream ENSMUSE00000126829 Chr15:83330352..83330532 CTGGATCATGAAGCCATGTG Chr15:83330434..83330453 60.07 50
upstream ENSMUSE00000126827 Chr15:83328582..83328716 GTGTCGCAGTCCACAAAAGA Chr15:83328693..83328712 59.88 50
upstream ENSMUSE00000247495 Chr15:83327750..83327858 No primer for this exon
upstream ENSMUSE00000247483 Chr15:83326702..83326845 AACCTGCGTCTCTACCTGGA Chr15:83326784..83326803 59.87 55
upstream ENSMUSE00000126840 Chr15:83322973..83323059 TGCTTTGAATGCTACGGCTA Chr15:83323016..83323035 59.61 45
upstream ENSMUSE00000680490 Chr15:83322304..83323055 GGTGTAGTGGTGGCTGACCT Chr15:83322830..83322849 60.03 60

*** Putative Vector Insertion (Chr 15: 83320063 - 83322303) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000247472 Chr15:83319899..83320062 GGGAGACTTGTTCCACTTGC Chr15:83319909..83319928 59.7 55
downstream ENSMUSE00000680492 Chr15:83314258..83314743 GTGCGTGTGTGTGTGTGTGT Chr15:83314381..83314400 60.18 55
downstream ENSMUSE00000377097 Chr15:83314202..83314743 GTGCGTGTGTGTGTGTGTGT Chr15:83314381..83314400 60.18 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr15:83322232..83322252 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000022442