Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20115
Trapped Gene
Gtdc1 (ENSMUSG00000036890)
Vector Insertion
Chr 2: 44715810 - 44715856
Public Clones not available
Private Clones OST372526 (lexicon) OST65687 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000708537 (Chr2:44715811..44715855 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000708537 (Chr2:44715811..44715855 -)
Downstram Exon
ENSMUSE00000717993 (Chr2:44715811..44715855 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000693251 Chr2:44717006..44717142 TCCTGACCTGCTTGAGTTCC Chr2:44717045..44717064 60.39 55
upstream ENSMUSE00000693250 Chr2:44715811..44715846 No primer for this exon
upstream ENSMUSE00000708537 Chr2:44715811..44715855 No primer for this exon
upstream ENSMUSE00000717993 Chr2:44715811..44715855 No primer for this exon

*** Putative Vector Insertion (Chr 2: 44715810 - 44715856) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000382626 Chr2:44680871..44681063 GCTCTCCAGTGCCATTTCTT Chr2:44680903..44680922 59.43 50
downstream ENSMUSE00000645480 Chr2:44680871..44681063 GCTCTCCAGTGCCATTTCTT Chr2:44680903..44680922 59.43 50
downstream ENSMUSE00000721982 Chr2:44680871..44681063 GCTCTCCAGTGCCATTTCTT Chr2:44680903..44680922 59.43 50
downstream ENSMUSE00000645476 Chr2:44644422..44644563 AGCAGCAGTTCCAGCTTCTC Chr2:44644516..44644535 59.9 55
downstream ENSMUSE00000275833 Chr2:44611788..44611955 GCAGCCAGTTCAGTCAGGTT Chr2:44611889..44611908 60.45 55
downstream ENSMUSE00000275828 Chr2:44607567..44607740 CCTTAGGCCTGTGATCAGGA Chr2:44607615..44607634 60.21 55
downstream ENSMUSE00000333997 Chr2:44490522..44490836 CATGTAATGTGCAGCGGTCT Chr2:44490512..44490531 59.75 50
downstream ENSMUSE00000712267 Chr2:44447401..44447510 No primer for this exon
downstream ENSMUSE00000717339 Chr2:44447401..44447510 No primer for this exon
downstream ENSMUSE00000275917 Chr2:44430963..44431107 TGCACAGTACGCGGAAATAG Chr2:44430993..44431012 59.9 50
downstream ENSMUSE00000693237 Chr2:44430963..44431107 TGCACAGTACGCGGAAATAG Chr2:44430993..44431012 59.9 50
downstream ENSMUSE00000275903 Chr2:44426733..44426803 GCTTTGGGACAGAGTGGGTA Chr2:44426737..44426756 60.11 55
downstream ENSMUSE00000693234 Chr2:44426733..44426803 GCTTTGGGACAGAGTGGGTA Chr2:44426737..44426756 60.11 55
downstream ENSMUSE00000275891 Chr2:44425939..44426030 TGGCCTCTTGCAGAAACTCT Chr2:44425944..44425963 60.13 50
downstream ENSMUSE00000693232 Chr2:44425939..44426030 TGGCCTCTTGCAGAAACTCT Chr2:44425944..44425963 60.13 50
downstream ENSMUSE00000645479 Chr2:44419942..44421054 GAATTCAGGCTCCGTGTCAT Chr2:44420555..44420574 60.08 50
downstream ENSMUSE00000693230 Chr2:44419942..44421054 GAATTCAGGCTCCGTGTCAT Chr2:44420555..44420574 60.08 50
downstream ENSMUSE00000693248 Chr2:44419932..44421054 GAATTCAGGCTCCGTGTCAT Chr2:44420555..44420574 60.08 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCCTTTTGTGATCTTGCAG Chr2:44715845..44715865 59.99 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCCTTTTGTGATCTTGCAG Chr2:44715845..44715865 59.99 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036890