Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20118
Trapped Gene
Gipc2 (ENSMUSG00000039131)
Vector Insertion
Chr 3: 151800723 - 151828611
Public Clones not available
Private Clones OST372448 (lexicon)
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000346457 (Chr3:151828612..151828875 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGCTCTACGCCAAGATTGC Chr3:151828640..151828659 60.12 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000346457 (Chr3:151828612..151828875 -)
Downstram Exon
ENSMUSE00000260059 (Chr3:151800537..151800722 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGCTCTACGCCAAGATTGC Chr3:151828640..151828659 60.12 55 TTTCACGTGGGCAAATATGA Chr3:151800605..151800624 59.93 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000346457 Chr3:151828612..151828875 GAGCTCTACGCCAAGATTGC Chr3:151828640..151828659 60.12 55

*** Putative Vector Insertion (Chr 3: 151800723 - 151828611) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000260059 Chr3:151800537..151800722 TTTCACGTGGGCAAATATGA Chr3:151800605..151800624 59.93 40
downstream ENSMUSE00000260054 Chr3:151791000..151791180 ATTCGATATGATCCCCCACA Chr3:151791095..151791114 59.97 45
downstream ENSMUSE00000260047 Chr3:151770905..151771011 GTTGATGTCTTTCCGGCTTT Chr3:151770953..151770972 59.17 45
downstream ENSMUSE00000260044 Chr3:151765583..151765664 TCATCAACCTTTCCGATTGC Chr3:151765602..151765621 60.98 45
downstream ENSMUSE00000394566 Chr3:151756807..151757259 CCCAGAGTCTCGTCAAGAGC Chr3:151757162..151757181 60.13 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGAAAGCTAATCGCCTTGC Chr3:151819548..151819568 60.12 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCAGCGTGACTGGGAAAAC Chr3:151819545..151819565 62.69 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039131