Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20125
Trapped Gene
AC113976.13 (ENSMUSG00000078938)
Vector Insertion
Chr 15: 89227866 - 89240621
Public Clones not available
Private Clones OST372201 (lexicon) OST372188 (lexicon) OST67687 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000679885 (Chr15:89240622..89240694 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGAGTCCCTCCTTCCTCTG Chr15:89240675..89240694 59.8 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000679885 (Chr15:89240622..89240694 -)
Downstram Exon
ENSMUSE00000679884 (Chr15:89227757..89227865 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGAGTCCCTCCTTCCTCTG Chr15:89240675..89240694 59.8 60 TCCAGGTCCTTGTTCAGGTC Chr15:89227767..89227786 60.09 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679885 Chr15:89240622..89240694 AGGAGTCCCTCCTTCCTCTG Chr15:89240675..89240694 59.8 60

*** Putative Vector Insertion (Chr 15: 89227866 - 89240621) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000679884 Chr15:89227757..89227865 TCCAGGTCCTTGTTCAGGTC Chr15:89227767..89227786 60.09 55
downstream ENSMUSE00000679883 Chr15:89220605..89220870 TGAGGAAGGCGTCTTCTAGC Chr15:89220756..89220775 59.72 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGGCATGCCTAGACCTAATC Chr15:89228565..89228585 59.69 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATGCCTAGACCCGTGACTG Chr15:89240562..89240582 61.67 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078938