Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20132
Trapped Gene
Ccl17 (ENSMUSG00000031780)
Vector Insertion
Chr 8: 97334472 - 97335085
Public Clones not available
Private Clones OST371944 (lexicon)
Severity of mutation (?) Insertion after 36% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000212914 (Chr8:97334353..97334471 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAGAAGGACCCATGAAGAC Chr8:97334360..97334379 59.66 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000212914 (Chr8:97334353..97334471 +)
Downstram Exon
ENSMUSE00000212915 (Chr8:97335086..97335203 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAGAAGGACCCATGAAGAC Chr8:97334360..97334379 59.66 55 CACTCTCGGCCTACATTGGT Chr8:97335116..97335135 60.13 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000212914 Chr8:97334353..97334471 GCAGAAGGACCCATGAAGAC Chr8:97334360..97334379 59.66 55

*** Putative Vector Insertion (Chr 8: 97334472 - 97335085) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000212915 Chr8:97335086..97335203 CACTCTCGGCCTACATTGGT Chr8:97335116..97335135 60.13 55
downstream ENSMUSE00000212916 Chr8:97335660..97335935 CTGGTCACAGGCCGTTTTAT Chr8:97335828..97335847 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGAACCATTCACCCACTAA Chr8:97334506..97334526 59.65 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCTTCTGGGGACTTTTCTG Chr8:97334437..97334457 60.37 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031780