Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20140
Trapped Gene
Cks1b (ENSMUSG00000028044)
Vector Insertion
Chr 3: 89219478 - 89219886
Public Clones CMHD-GT_464C5-3 (cmhd)
Private Clones OST371683 (lexicon) OST339239 (lexicon) OST199375 (lexicon) OST109106 (lexicon)
OST84413 (lexicon) OST44096 (lexicon)
Severity of mutation (?) Insertion after 71% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000507910 (Chr3:89219479..89219885 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTGTGAATTTGCTGACGTG Chr3:89219528..89219547 60.16 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000507910 (Chr3:89219479..89219885 -)
Downstram Exon
ENSMUSE00000175425 (Chr3:89219396..89219885 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTGTGAATTTGCTGACGTG Chr3:89219528..89219547 60.16 50 CACGTCAGCAAATTCACACC Chr3:89219506..89219525 60.16 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000175427 Chr3:89222077..89222200 ATACGACGACGAGGAGTTCG Chr3:89222084..89222103 60.28 55
upstream ENSMUSE00000673064 Chr3:89221709..89221939 GGTGGACGGAGGATGTAAAA Chr3:89221877..89221896 59.79 50
upstream ENSMUSE00000566837 Chr3:89220196..89220323 CCGAAAACCCATCTGATGTC Chr3:89220267..89220286 60.32 50
upstream ENSMUSE00000673062 Chr3:89220196..89220323 CCGAAAACCCATCTGATGTC Chr3:89220267..89220286 60.32 50
upstream ENSMUSE00000507910 Chr3:89219479..89219885 GGTGTGAATTTGCTGACGTG Chr3:89219528..89219547 60.16 50

*** Putative Vector Insertion (Chr 3: 89219478 - 89219886) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000175425 Chr3:89219396..89219885 CACGTCAGCAAATTCACACC Chr3:89219506..89219525 60.16 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr3:89219816..89219836 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGCCAAAGAACGTGACTGG Chr3:89219826..89219846 60.29 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028044