Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20143
Trapped Gene
Armc6 (ENSMUSG00000002343)
Vector Insertion
Chr 8: 72753510 - 72755178
Public Clones not available
Private Clones OST371654 (lexicon) OST53962 (lexicon)
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000348219 (Chr8:72755179..72755305 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000348219 (Chr8:72755179..72755305 -)
Downstram Exon
ENSMUSE00000369759 (Chr8:72753427..72753509 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000233624 Chr8:72758009..72758365 No primer for this exon
upstream ENSMUSE00000348219 Chr8:72755179..72755305 No primer for this exon

*** Putative Vector Insertion (Chr 8: 72753510 - 72755178) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000369759 Chr8:72753427..72753509 No primer for this exon
downstream ENSMUSE00000404974 Chr8:72748799..72749372 No primer for this exon
downstream ENSMUSE00000213915 Chr8:72747443..72747588 No primer for this exon
downstream ENSMUSE00000213913 Chr8:72746417..72746548 No primer for this exon
downstream ENSMUSE00000213912 Chr8:72746005..72746142 No primer for this exon
downstream ENSMUSE00000333576 Chr8:72744094..72744776 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACAGCCCTCAGCCTTAATC Chr8:72755122..72755142 59.84 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGCTGTGGAGCAGTTTGAA Chr8:72755184..72755204 60.97 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002343