Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20144
Trapped Gene
Ccdc71 (ENSMUSG00000049305)
Vector Insertion
Chr 9: 108362949 - 108365268
Public Clones (sanger) (sanger) E130D01 (ggtc) (cmhd)
Private Clones OST371474 (lexicon) OST245752 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000426402 (Chr9:108362897..108362948 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000426402 (Chr9:108362897..108362948 +)
Downstram Exon
ENSMUSE00000346818 (Chr9:108365269..108366884 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCAGCAGCAGGTTAGTGGTG Chr9:108365741..108365760 60.05 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000426402 Chr9:108362897..108362948 No primer for this exon

*** Putative Vector Insertion (Chr 9: 108362949 - 108365268) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000346818 Chr9:108365269..108366884 TCAGCAGCAGGTTAGTGGTG Chr9:108365741..108365760 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGAGCGTGACTGGGAAAAC Chr9:108362995..108363015 60.12 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049305