Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20164
Trapped Gene
E130309D14Rik (ENSMUSG00000069814)
Vector Insertion
Chr 11: 74433349 - 74443460
Public Clones IST10994C3 (tigm) IST14957F5 (tigm) IST14575G5 (tigm) IST14126E6 (tigm)
IST14957F5 (tigm) IST14494D2 (tigm)
Private Clones OST370410 (lexicon) OST357205 (lexicon) OST312941 (lexicon) OST288430 (lexicon)
OST278079 (lexicon) OST275725 (lexicon) OST274192 (lexicon) OST250687 (lexicon)
OST250201 (lexicon) OST249857 (lexicon) OST246562 (lexicon) OST245218 (lexicon)
OST245193 (lexicon) OST179267 (lexicon) OST175209 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000719478 (Chr11:74433107..74433348 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCACGTTGCTGGGTGTTTAC Chr11:74433122..74433141 59.62 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000719478 (Chr11:74433107..74433348 +)
Downstram Exon
ENSMUSE00000578455 (Chr11:74443461..74443613 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCACGTTGCTGGGTGTTTAC Chr11:74433122..74433141 59.62 50 GATCTCCAGGTGCAGGTCTC Chr11:74443591..74443610 59.8 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000578456 Chr11:74433107..74433348 TCACGTTGCTGGGTGTTTAC Chr11:74433122..74433141 59.62 50
upstream ENSMUSE00000719478 Chr11:74433107..74433348 TCACGTTGCTGGGTGTTTAC Chr11:74433122..74433141 59.62 50

*** Putative Vector Insertion (Chr 11: 74433349 - 74443460) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000578455 Chr11:74443461..74443613 GATCTCCAGGTGCAGGTCTC Chr11:74443591..74443610 59.8 60
downstream ENSMUSE00000578454 Chr11:74448743..74448790 CTCTCTCATCTCCAGGTCGTG Chr11:74448773..74448793 59.99 57.14
downstream ENSMUSE00000676832 Chr11:74448885..74448925 CCTTCTTCTGGAGTGTCTGAAG Chr11:74448926..74448947 58.19 50
downstream ENSMUSE00000676831 Chr11:74449404..74449431 CGGCCCAAGTGAGACTTAAA Chr11:74449429..74449448 60.24 50
downstream ENSMUSE00000676830 Chr11:74449523..74449559 No primer for this exon
downstream ENSMUSE00000676829 Chr11:74450111..74450141 CCTCCCTCCTGAAACAATGA Chr11:74450138..74450157 60.04 50
downstream ENSMUSE00000676828 Chr11:74450802..74450811 No primer for this exon
downstream ENSMUSE00000676827 Chr11:74450889..74450903 No primer for this exon
downstream ENSMUSE00000676826 Chr11:74451319..74451339 GGCGCAGCGTAGTAAATAATC Chr11:74451341..74451361 58.93 47.62
downstream ENSMUSE00000650861 Chr11:74451460..74455018 AGGTGGGACAGGTATTGCAG Chr11:74453664..74453683 59.99 55
downstream ENSMUSE00000650863 Chr11:74451587..74452290 TTACTGCCAGTCCACCACAA Chr11:74452293..74452312 60.15 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr11:74433400..74433420 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCACGTGACTGGGAAAACC Chr11:74433396..74433416 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000069814