Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20168
Trapped Gene
Zfp541 (ENSMUSG00000078796)
Vector Insertion
Chr 7: 16668922 - 16675145
Public Clones not available
Private Clones OST370338 (lexicon)
Severity of mutation (?) Insertion after 76% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000677004 (Chr7:16668570..16668921 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCAGTACAGAAAGCGGAAG Chr7:16668646..16668665 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000677004 (Chr7:16668570..16668921 +)
Downstram Exon
ENSMUSE00000677003 (Chr7:16675146..16675209 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCAGTACAGAAAGCGGAAG Chr7:16668646..16668665 60.01 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000677011 Chr7:16657291..16657597 TAAGCGGTTTGGACCTTGAC Chr7:16657436..16657455 60.11 50
upstream ENSMUSE00000677010 Chr7:16661696..16661936 TGAGCAAGCATTACCTGACG Chr7:16661852..16661871 60.01 50
upstream ENSMUSE00000677009 Chr7:16663321..16665175 CCTTCGCTGTATTGTGAGCA Chr7:16663594..16663613 60.01 50
upstream ENSMUSE00000677008 Chr7:16667027..16667085 TTACAGACTCCCCCATCCAG Chr7:16667038..16667057 59.92 55
upstream ENSMUSE00000677007 Chr7:16667401..16667587 AGCAGGAGCAACAGGTGAAG Chr7:16667547..16667566 60.59 55
upstream ENSMUSE00000677006 Chr7:16667859..16667919 CAGGGAGGAAGGAGCAGTAG Chr7:16667873..16667892 59.04 60
upstream ENSMUSE00000677005 Chr7:16668348..16668409 GAGCCTCAGGATGTCACCAT Chr7:16668356..16668375 60.08 55
upstream ENSMUSE00000677004 Chr7:16668570..16668921 GCCAGTACAGAAAGCGGAAG Chr7:16668646..16668665 60.01 55

*** Putative Vector Insertion (Chr 7: 16668922 - 16675145) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000677003 Chr7:16675146..16675209 No primer for this exon
downstream ENSMUSE00000677002 Chr7:16675709..16675851 GGGTTGGTCATCACATCTCC Chr7:16675837..16675856 60.18 55
downstream ENSMUSE00000677001 Chr7:16676157..16676260 AGCATGCTACATTGCAGAGC Chr7:16676186..16676205 59.21 50
downstream ENSMUSE00000677000 Chr7:16677635..16677710 GCTTCTGGGGTCCTCTGAGT Chr7:16677677..16677696 60.79 60
downstream ENSMUSE00000676999 Chr7:16678188..16678276 No primer for this exon
downstream ENSMUSE00000676998 Chr7:16680491..16680631 TCGGCCACAATCAAACTTAAC Chr7:16680570..16680590 59.99 42.86
downstream ENSMUSE00000676997 Chr7:16680769..16680950 ACTCTCTGCAAGGGAACACG Chr7:16680946..16680965 60.44 55
downstream ENSMUSE00000676996 Chr7:16681040..16681677 AAATGCTAGCAAGGCTGGAA Chr7:16681338..16681357 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr7:16668972..16668992 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTCCAGGATCAGGTGCTTC Chr7:16674948..16674968 59.66 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078796