Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20174
Trapped Gene
Vars (ENSMUSG00000007029)
Vector Insertion
Chr 17: 35138776 - 35141149
Public Clones (sanger) IST14536B4 (tigm) IST15013B12 (tigm) IST14945F5 (tigm) IST14223B11 (tigm)
IST15013B11 (tigm)
Private Clones OST370119 (lexicon) OST51352 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000141627 (Chr17:35138357..35138775 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000141627 (Chr17:35138357..35138775 +)
Downstram Exon
ENSMUSE00000141605 (Chr17:35141150..35141284 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000362300 Chr17:35138078..35138177 No primer for this exon
upstream ENSMUSE00000141627 Chr17:35138357..35138775 No primer for this exon

*** Putative Vector Insertion (Chr 17: 35138776 - 35141149) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000141605 Chr17:35141150..35141284 No primer for this exon
downstream ENSMUSE00000141603 Chr17:35141382..35141520 No primer for this exon
downstream ENSMUSE00000354480 Chr17:35141717..35141838 No primer for this exon
downstream ENSMUSE00000141604 Chr17:35141922..35142006 No primer for this exon
downstream ENSMUSE00000349518 Chr17:35142195..35142295 No primer for this exon
downstream ENSMUSE00000141610 Chr17:35142420..35142547 No primer for this exon
downstream ENSMUSE00000141611 Chr17:35147451..35147615 No primer for this exon
downstream ENSMUSE00000141636 Chr17:35147783..35147864 No primer for this exon
downstream ENSMUSE00000141625 Chr17:35148150..35148269 No primer for this exon
downstream ENSMUSE00000141624 Chr17:35148352..35148460 No primer for this exon
downstream ENSMUSE00000141628 Chr17:35148545..35148639 No primer for this exon
downstream ENSMUSE00000141645 Chr17:35148753..35148843 No primer for this exon
downstream ENSMUSE00000141616 Chr17:35149034..35149158 No primer for this exon
downstream ENSMUSE00000141607 Chr17:35149242..35149345 No primer for this exon
downstream ENSMUSE00000141609 Chr17:35149435..35149593 No primer for this exon
downstream ENSMUSE00000141632 Chr17:35149675..35149765 No primer for this exon
downstream ENSMUSE00000544934 Chr17:35149875..35149980 No primer for this exon
downstream ENSMUSE00000141643 Chr17:35150067..35150137 No primer for this exon
downstream ENSMUSE00000141640 Chr17:35150210..35150335 No primer for this exon
downstream ENSMUSE00000141622 Chr17:35150588..35150692 No primer for this exon
downstream ENSMUSE00000141637 Chr17:35150773..35150841 No primer for this exon
downstream ENSMUSE00000141634 Chr17:35150971..35151049 No primer for this exon
downstream ENSMUSE00000141638 Chr17:35151179..35151306 No primer for this exon
downstream ENSMUSE00000141626 Chr17:35151567..35151722 No primer for this exon
downstream ENSMUSE00000141614 Chr17:35151882..35152088 No primer for this exon
downstream ENSMUSE00000141620 Chr17:35152310..35152421 No primer for this exon
downstream ENSMUSE00000358807 Chr17:35152539..35152864 No primer for this exon
downstream ENSMUSE00000141630 Chr17:35153132..35153267 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGATTGGGTAATCGCCTTG Chr17:35138818..35138838 61.19 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGGTGAGAGGGAAGAAAA Chr17:35138773..35138793 59.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000007029