Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20178
Trapped Gene
Fbxo27 (ENSMUSG00000037463)
Vector Insertion
Chr 7: 29478288 - 29478670
Public Clones not available
Private Clones OST370047 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000676206 (Chr7:29478163..29478669 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATGTTAGTCTCGGGGTGGA Chr7:29478206..29478225 59.93 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000676206 (Chr7:29478163..29478669 +)
Downstram Exon
ENSMUSE00000253896 (Chr7:29478289..29478669 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATGTTAGTCTCGGGGTGGA Chr7:29478206..29478225 59.93 55 GCTGATGAGGTTGCGTCCTA Chr7:29478656..29478675 61.35 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000466501 Chr7:29477868..29477991 AGAGCCCTGGCCTAATCTGT Chr7:29477923..29477942 60.23 55
upstream ENSMUSE00000676206 Chr7:29478163..29478669 GATGTTAGTCTCGGGGTGGA Chr7:29478206..29478225 59.93 55
upstream ENSMUSE00000713587 Chr7:29478163..29478669 GATGTTAGTCTCGGGGTGGA Chr7:29478206..29478225 59.93 55

*** Putative Vector Insertion (Chr 7: 29478288 - 29478670) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000253896 Chr7:29478289..29478669 GCTGATGAGGTTGCGTCCTA Chr7:29478656..29478675 61.35 55
downstream ENSMUSE00000644028 Chr7:29479038..29479627 CACCTGTACGCGAGACTTGA Chr7:29479514..29479533 60.05 55
downstream ENSMUSE00000676201 Chr7:29479750..29479861 AGGAAGTCACGAAGCAGGTC Chr7:29479860..29479879 59.46 55
downstream ENSMUSE00000676202 Chr7:29479750..29479861 AGGAAGTCACGAAGCAGGTC Chr7:29479860..29479879 59.46 55
downstream ENSMUSE00000597644 Chr7:29479753..29479861 AGGAAGTCACGAAGCAGGTC Chr7:29479860..29479879 59.46 55
downstream ENSMUSE00000253880 Chr7:29480025..29480120 AGACAGCAATCTCCACACCA Chr7:29480116..29480135 59.26 50
downstream ENSMUSE00000253872 Chr7:29481659..29481794 GCATCAAGAAGCGTGACAAA Chr7:29481721..29481740 59.99 45
downstream ENSMUSE00000404749 Chr7:29483258..29484353 TGGTACTGGTGTGTGCCTGT Chr7:29483918..29483937 60.07 55
downstream ENSMUSE00000676203 Chr7:29483258..29484354 TGGTACTGGTGTGTGCCTGT Chr7:29483918..29483937 60.07 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000037463