Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20257
Trapped Gene
Crmp1 (ENSMUSG00000029121)
Vector Insertion
Chr 5: 37680210 - 37682355
Public Clones not available
Private Clones OST368735 (lexicon)
Severity of mutation (?) Insertion after 95% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000185810 (Chr5:37680044..37680209 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTCGCCTTCTAAACACCAA Chr5:37680144..37680163 60.24 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000185810 (Chr5:37680044..37680209 +)
Downstram Exon
ENSMUSE00000698322 (Chr5:37682356..37683371 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTCGCCTTCTAAACACCAA Chr5:37680144..37680163 60.24 50 CCTGTACGCCTTGGATTGTT Chr5:37682395..37682414 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000546345 Chr5:37633384..37633764 ATCGACTTCGACGCCTACAG Chr5:37633525..37633544 60.42 55
upstream ENSMUSE00000546315 Chr5:37637031..37637335 CCATGTCTCATCAGGGGAAG Chr5:37637295..37637314 60.47 55
upstream ENSMUSE00000546344 Chr5:37656471..37656559 CAGTCCTTCTACGCCGATGT Chr5:37656516..37656535 60.28 55
upstream ENSMUSE00000400790 Chr5:37659922..37660106 CTCGGCTGATGACTTCTTCC Chr5:37660045..37660064 59.95 55
upstream ENSMUSE00000185817 Chr5:37664586..37664750 ATGATGGTGTTCGGGAAGAG Chr5:37664706..37664725 59.93 50
upstream ENSMUSE00000185816 Chr5:37667516..37667577 No primer for this exon
upstream ENSMUSE00000185809 Chr5:37669324..37669404 TAAGGGTTTGGGAGCTGTGA Chr5:37669347..37669366 60.63 50
upstream ENSMUSE00000185812 Chr5:37670102..37670170 ACAAAAACGGATCCTGGAGA Chr5:37670104..37670123 59.53 45
upstream ENSMUSE00000185814 Chr5:37670898..37671018 AAGAGTGCAGCGGACATCAT Chr5:37670979..37670998 60.83 50
upstream ENSMUSE00000653836 Chr5:37670898..37670976 GCCCTGTGTACATCACCAAG Chr5:37670950..37670969 59.01 55
upstream ENSMUSE00000185811 Chr5:37671706..37671862 GCACCCACTACTGGAGCAAG Chr5:37671754..37671773 60.85 60
upstream ENSMUSE00000185808 Chr5:37674091..37674232 TTGCAGGTCACAGGTAGTGG Chr5:37674098..37674117 59.74 55
upstream ENSMUSE00000185807 Chr5:37675267..37675437 ACCAGTTTGTAGCCGTCACC Chr5:37675289..37675308 60.03 55
upstream ENSMUSE00000185818 Chr5:37677607..37677786 GCATCTCTACCAGCGTGTCA Chr5:37677753..37677772 60.02 55
upstream ENSMUSE00000653834 Chr5:37677674..37677786 TACCAGCGTGTCAGGATCAG Chr5:37677760..37677779 59.85 55
upstream ENSMUSE00000185810 Chr5:37680044..37680209 CCTCGCCTTCTAAACACCAA Chr5:37680144..37680163 60.24 50

*** Putative Vector Insertion (Chr 5: 37680210 - 37682355) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000698322 Chr5:37682356..37683371 CCTGTACGCCTTGGATTGTT Chr5:37682395..37682414 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCTCCACCAGTCCAACTTC Chr5:37680181..37680201 59 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCTCCACCAGTCCAACTTC Chr5:37680181..37680201 59 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029121