Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20265
Trapped Gene
Galk2 (ENSMUSG00000027207)
Vector Insertion
Chr 2: 125692122 - 125704013
Public Clones not available
Private Clones OST368572 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000559944 (Chr2:125691989..125692121 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTGCTGCACTTCTGGAAAC Chr2:125692028..125692047 60.03 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000559944 (Chr2:125691989..125692121 +)
Downstram Exon
ENSMUSE00000641499 (Chr2:125704014..125704102 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTGCTGCACTTCTGGAAAC Chr2:125692028..125692047 60.03 50 CTGGGGCTCGAACATAAAAC Chr2:125704087..125704106 59.57 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000597199 Chr2:125685094..125685113 No primer for this exon
upstream ENSMUSE00000559944 Chr2:125691989..125692121 TGTGCTGCACTTCTGGAAAC Chr2:125692028..125692047 60.03 50
upstream ENSMUSE00000684009 Chr2:125692004..125692121 TGTGCTGCACTTCTGGAAAC Chr2:125692028..125692047 60.03 50

*** Putative Vector Insertion (Chr 2: 125692122 - 125704013) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000641499 Chr2:125704014..125704102 CTGGGGCTCGAACATAAAAC Chr2:125704087..125704106 59.57 50
downstream ENSMUSE00000641498 Chr2:125713600..125713723 GCCATGGGAATAACGGAATA Chr2:125713645..125713664 59.62 45
downstream ENSMUSE00000641497 Chr2:125719089..125719179 TTGTGCCATAGAGGTTTGGTC Chr2:125719150..125719170 59.99 47.62
downstream ENSMUSE00000641496 Chr2:125722381..125722527 CCGAACTCGGGGGTATATTT Chr2:125722453..125722472 60.03 50
downstream ENSMUSE00000641495 Chr2:125755297..125755395 GCCACCTTCAGTGCCTATGT Chr2:125755356..125755375 60.14 55
downstream ENSMUSE00000641493 Chr2:125756989..125757141 GTCGCTCTCAGAGGGCTAAA Chr2:125757026..125757045 59.72 55
downstream ENSMUSE00000641492 Chr2:125772520..125772730 GCAGGACATTATCCCATTGC Chr2:125772565..125772584 60.3 50
downstream ENSMUSE00000684008 Chr2:125772520..125773086 TAATCCCGAGTTTGCTTTGC Chr2:125772598..125772617 60.21 45
downstream ENSMUSE00000641491 Chr2:125800996..125801197 GTCTGGCGCATCTTCACATA Chr2:125801093..125801112 59.83 50
downstream ENSMUSE00000597190 Chr2:125808791..125809321 TGCTCCAGTAAGTCGTGAGC Chr2:125808830..125808849 59.19 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGTCCAGGTGGCAGAACAT Chr2:125695098..125695118 60.12 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCCAGGTGGCAGAACATCC Chr2:125695100..125695120 62.88 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027207