Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2027
Trapped Gene
Ube2v1 (ENSMUSG00000078923)
Vector Insertion
Chr 2: 167443478 - 167457439
Public Clones AY0842 (sanger) (sanger) YTC022 (baygenomics) XE365 (baygenomics) (egtc)
Private Clones OST366810 (lexicon) OST359746 (lexicon) OST60681 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000679423 (Chr2:167457440..167457472 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000679423 (Chr2:167457440..167457472 -)
Downstram Exon
ENSMUSE00000346524 (Chr2:167443329..167443477 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CGGAAATTTCGAGGGACTTT Chr2:167443431..167443450 60.42 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000479980 Chr2:167457440..167457474 No primer for this exon
upstream ENSMUSE00000679423 Chr2:167457440..167457472 No primer for this exon

*** Putative Vector Insertion (Chr 2: 167443478 - 167457439) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000346524 Chr2:167443329..167443477 CGGAAATTTCGAGGGACTTT Chr2:167443431..167443450 60.42 45
downstream ENSMUSE00000172371 Chr2:167435804..167435929 ACGCCGCTCATATTGACTCT Chr2:167435801..167435820 59.87 50
downstream ENSMUSE00000679424 Chr2:167433349..167434747 AGAGGGTCTGAGGAGCAACA Chr2:167433484..167433503 59.99 55
downstream ENSMUSE00000476831 Chr2:167433344..167434747 AGAGGGTCTGAGGAGCAACA Chr2:167433484..167433503 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr2:167454368..167454388 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTGTAATAGGCCCCAGTT Chr2:167457407..167457427 60.2 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TAATCGCCTTGCAGCACATC Chr2:167445402..167445422 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTTCCACTCAAGGGTGTTCC Chr2:167457461..167457481 59.55 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078923