Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20273
Trapped Gene
Id1 (ENSMUSG00000042745)
Vector Insertion
Chr 2: 152562482 - 152562707
Public Clones not available
Private Clones OST368455 (lexicon) OST339958 (lexicon) OST195712 (lexicon)
Severity of mutation (?) Insertion after 91% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000442315 (Chr2:152562010..152562481 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCTGCAGCATGTAATCGAC Chr2:152562336..152562355 59.83 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000442315 (Chr2:152562010..152562481 +)
Downstram Exon
ENSMUSE00000279463 (Chr2:152562708..152563142 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCTGCAGCATGTAATCGAC Chr2:152562336..152562355 59.83 50 AGAAATCCGAGAAGCACGAA Chr2:152563038..152563057 59.96 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681723 Chr2:152561987..152563146 TTCGTGCTTCTCGGATTTCT Chr2:152563016..152563035 59.96 45
upstream ENSMUSE00000442315 Chr2:152562010..152562481 TCCTGCAGCATGTAATCGAC Chr2:152562336..152562355 59.83 50

*** Putative Vector Insertion (Chr 2: 152562482 - 152562707) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000279463 Chr2:152562708..152563142 AGAAATCCGAGAAGCACGAA Chr2:152563038..152563057 59.96 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGGGAAACCGAGGCTAATC Chr2:152562518..152562538 60.83 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTCCGAGGCAGAGTATTACA Chr2:152562487..152562508 59.21 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042745