Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20275
Trapped Gene
Mpped2 (ENSMUSG00000016386)
Vector Insertion
Chr 2: 106539693 - 106584856
Public Clones not available
Private Clones OST368417 (lexicon) OST271457 (lexicon) OST46333 (lexicon) OST29702 (lexicon)
OST29674 (lexicon)
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000405943 (Chr2:106539445..106539692 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000405943 (Chr2:106539445..106539692 +)
Downstram Exon
ENSMUSE00000599134 (Chr2:106584857..106585038 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000686567 Chr2:106533426..106533978 No primer for this exon
upstream ENSMUSE00000686573 Chr2:106533426..106533971 No primer for this exon
upstream ENSMUSE00000642723 Chr2:106535758..106535833 No primer for this exon
upstream ENSMUSE00000686572 Chr2:106539441..106539692 No primer for this exon
upstream ENSMUSE00000405943 Chr2:106539445..106539692 No primer for this exon

*** Putative Vector Insertion (Chr 2: 106539693 - 106584856) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000599134 Chr2:106584857..106585038 No primer for this exon
downstream ENSMUSE00000599133 Chr2:106623790..106624015 No primer for this exon
downstream ENSMUSE00000166268 Chr2:106701645..106701760 No primer for this exon
downstream ENSMUSE00000166267 Chr2:106704812..106704925 No primer for this exon
downstream ENSMUSE00000642716 Chr2:106707105..106707359 No primer for this exon
downstream ENSMUSE00000686566 Chr2:106707105..106708513 No primer for this exon
downstream ENSMUSE00000686568 Chr2:106707105..106708510 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACATGGACTAATCGCCTTGC Chr2:106539736..106539756 60.1 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACAGAAAGATGACCGGAAA Chr2:106539670..106539690 58.69 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000016386