Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20281
Trapped Gene
Tdrd3 (ENSMUSG00000022019)
Vector Insertion
Chr 14: 87816656 - 87856840
Public Clones IST12328C3 (tigm) IST14631B4 (tigm) IST11321G1 (tigm) IST14148A6 (tigm)
IST14392G5 (tigm) IST14261G11 (tigm)
Private Clones OST368313 (lexicon) OST356049 (lexicon) OST124979 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000612790 (Chr14:87816489..87816655 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGAGCCTGAACAGCTAACCA Chr14:87816596..87816615 61.5 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000612790 (Chr14:87816489..87816655 +)
Downstram Exon
ENSMUSE00000612789 (Chr14:87856841..87856925 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGAGCCTGAACAGCTAACCA Chr14:87816596..87816615 61.5 55 GAGCTTGTGCAGGCTTCAAC Chr14:87856882..87856901 61.13 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000612790 Chr14:87816489..87816655 CGAGCCTGAACAGCTAACCA Chr14:87816596..87816615 61.5 55

*** Putative Vector Insertion (Chr 14: 87816656 - 87856840) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000612789 Chr14:87856841..87856925 GAGCTTGTGCAGGCTTCAAC Chr14:87856882..87856901 61.13 55
downstream ENSMUSE00000612788 Chr14:87858564..87858629 ACCTTTCCACCGTTGATGTC Chr14:87858625..87858644 59.83 50
downstream ENSMUSE00000488064 Chr14:87871883..87872043 GCTTGCGATTCCTCGTTATC Chr14:87871962..87871981 59.81 50
downstream ENSMUSE00000553911 Chr14:87874506..87874647 TGTTCCACTTCACCACCAAG Chr14:87874622..87874641 59.56 50
downstream ENSMUSE00000122963 Chr14:87877197..87877268 TGCCCAAAAGGTAGAAAAGG Chr14:87877270..87877289 59.2 45
downstream ENSMUSE00000122960 Chr14:87880541..87880690 AATGGCAGCAGTTCTTTGCT Chr14:87880669..87880688 60.02 45
downstream ENSMUSE00000122962 Chr14:87885366..87885506 CTCCCTATTTCGGTGACCAG Chr14:87885446..87885465 59.54 55
downstream ENSMUSE00000122955 Chr14:87885999..87886155 TGTTGGCATTATCCATCAGC Chr14:87886086..87886105 59.5 45
downstream ENSMUSE00000122958 Chr14:87886969..87887094 GGTTCCCAGGTCTTCCTCAT Chr14:87887027..87887046 60.31 55
downstream ENSMUSE00000284834 Chr14:87905566..87906413 CATTGTCCGTGGTTTCCTCT Chr14:87906089..87906108 59.97 50
downstream ENSMUSE00000284824 Chr14:87911452..87911577 CGCTGTCATACCCGAAGAAT Chr14:87911502..87911521 60.1 50
downstream ENSMUSE00000388834 Chr14:87939204..87939328 TTGGTAAAACTGCTGCGTTG Chr14:87939302..87939321 59.91 45
downstream ENSMUSE00000612787 Chr14:87945064..87945307 CCCCATTGCCTTGTGTAAAT Chr14:87945228..87945247 59.69 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGCTATGTGAGGGGGTTT Chr14:87825688..87825708 59.55 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCTGAACTGGATTGCGTGA Chr14:87819692..87819712 59.84 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022019