Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20287
Trapped Gene
Ruvbl2 (ENSMUSG00000003868)
Vector Insertion
Chr 7: 52679748 - 52680051
Public Clones not available
Private Clones OST368248 (lexicon)
Severity of mutation (?) Insertion after 57% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000203765 (Chr7:52680052..52680175 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000203765 (Chr7:52680052..52680175 -)
Downstram Exon
ENSMUSE00000203749 (Chr7:52679653..52679747 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000531860 Chr7:52693402..52693466 No primer for this exon
upstream ENSMUSE00000531859 Chr7:52691837..52691921 No primer for this exon
upstream ENSMUSE00000531858 Chr7:52690251..52690707 No primer for this exon
upstream ENSMUSE00000361703 Chr7:52689622..52689726 No primer for this exon
upstream ENSMUSE00000674406 Chr7:52689622..52689655 No primer for this exon
upstream ENSMUSE00000399432 Chr7:52686690..52686744 No primer for this exon
upstream ENSMUSE00000268061 Chr7:52685279..52685334 No primer for this exon
upstream ENSMUSE00000268055 Chr7:52684824..52684965 No primer for this exon
upstream ENSMUSE00000268050 Chr7:52684023..52684152 No primer for this exon
upstream ENSMUSE00000268045 Chr7:52683849..52683915 No primer for this exon
upstream ENSMUSE00000268042 Chr7:52680514..52680620 No primer for this exon
upstream ENSMUSE00000203761 Chr7:52680321..52680414 No primer for this exon
upstream ENSMUSE00000203765 Chr7:52680052..52680175 No primer for this exon

*** Putative Vector Insertion (Chr 7: 52679748 - 52680051) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000203749 Chr7:52679653..52679747 No primer for this exon
downstream ENSMUSE00000203740 Chr7:52679449..52679567 No primer for this exon
downstream ENSMUSE00000203751 Chr7:52678058..52678177 No primer for this exon
downstream ENSMUSE00000203747 Chr7:52677755..52677884 No primer for this exon
downstream ENSMUSE00000203745 Chr7:52677462..52677576 No primer for this exon
downstream ENSMUSE00000203755 Chr7:52677268..52677375 No primer for this exon
downstream ENSMUSE00000674399 Chr7:52677222..52677375 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTTGGTGCTAATCGCCTTG Chr7:52679989..52680009 60.76 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGCCTTGAATGCTTTGGT Chr7:52680002..52680022 60.99 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003868