Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20300
Trapped Gene
Nup188 (ENSMUSG00000052533)
Vector Insertion
Chr 2: 30192598 - 30192743
Public Clones not available
Private Clones OST367852 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000696435 (Chr2:30192452..30192597 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGTGGAGAAAATCCTTGG Chr2:30192462..30192481 59.67 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000696435 (Chr2:30192452..30192597 +)
Downstram Exon
ENSMUSE00000359163 (Chr2:30192744..30192925 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGTGGAGAAAATCCTTGG Chr2:30192462..30192481 59.67 50 CTGTCTCCATGCTGTCCTTG Chr2:30192887..30192906 59.42 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696496 Chr2:30141949..30141990 No primer for this exon
upstream ENSMUSE00000713746 Chr2:30141953..30141990 No primer for this exon
upstream ENSMUSE00000718076 Chr2:30141953..30141990 No primer for this exon
upstream ENSMUSE00000344614 Chr2:30152168..30152222 No primer for this exon
upstream ENSMUSE00000696487 Chr2:30152168..30152222 No primer for this exon
upstream ENSMUSE00000387349 Chr2:30153936..30154009 ATCAGATTGAGGCGGAACTG Chr2:30153937..30153956 60.22 50
upstream ENSMUSE00000696484 Chr2:30153936..30154009 ATCAGATTGAGGCGGAACTG Chr2:30153937..30153956 60.22 50
upstream ENSMUSE00000351998 Chr2:30156320..30156404 AGGAGCTGGGCCTAAGAGTC Chr2:30156373..30156392 59.98 60
upstream ENSMUSE00000696480 Chr2:30156320..30156404 AGGAGCTGGGCCTAAGAGTC Chr2:30156373..30156392 59.98 60
upstream ENSMUSE00000378656 Chr2:30156529..30156609 AGGGGTACTCGGGACTCACT Chr2:30156586..30156605 59.99 60
upstream ENSMUSE00000696477 Chr2:30156529..30156609 AGGGGTACTCGGGACTCACT Chr2:30156586..30156605 59.99 60
upstream ENSMUSE00000450871 Chr2:30157521..30157565 No primer for this exon
upstream ENSMUSE00000696474 Chr2:30157521..30157565 No primer for this exon
upstream ENSMUSE00000696493 Chr2:30159180..30159275 CAGGAATGCCTTACCTCTGG Chr2:30159215..30159234 59.69 55
upstream ENSMUSE00000284835 Chr2:30159577..30159669 CAAGATGAACGCCATCCATA Chr2:30159646..30159665 59.5 45
upstream ENSMUSE00000696472 Chr2:30159577..30159669 CAAGATGAACGCCATCCATA Chr2:30159646..30159665 59.5 45
upstream ENSMUSE00000284825 Chr2:30159802..30159921 AAAGTACCGGCAGCAGTTTG Chr2:30159849..30159868 60.31 50
upstream ENSMUSE00000696470 Chr2:30159802..30159921 AAAGTACCGGCAGCAGTTTG Chr2:30159849..30159868 60.31 50
upstream ENSMUSE00000284814 Chr2:30163041..30163252 TGTTCAAGGAGCAAGGGTTT Chr2:30163168..30163187 59.71 45
upstream ENSMUSE00000696468 Chr2:30163041..30163252 TGTTCAAGGAGCAAGGGTTT Chr2:30163168..30163187 59.71 45
upstream ENSMUSE00000284804 Chr2:30164739..30164853 CAAGTACGCCTTGGATGACA Chr2:30164790..30164809 59.72 50
upstream ENSMUSE00000696467 Chr2:30164739..30164853 CAAGTACGCCTTGGATGACA Chr2:30164790..30164809 59.72 50
upstream ENSMUSE00000401623 Chr2:30165398..30165598 CAGCAGTGTGGTCAGGAAGA Chr2:30165499..30165518 60.02 55
upstream ENSMUSE00000696465 Chr2:30165398..30165598 CAGCAGTGTGGTCAGGAAGA Chr2:30165499..30165518 60.02 55
upstream ENSMUSE00000284797 Chr2:30168120..30168209 TCACTGGAGCTGCACACACT Chr2:30168177..30168196 60.69 55
upstream ENSMUSE00000696463 Chr2:30168120..30168209 TCACTGGAGCTGCACACACT Chr2:30168177..30168196 60.69 55
upstream ENSMUSE00000284790 Chr2:30170636..30170701 ATGTGAAGTCCTGGCAGACC Chr2:30170653..30170672 60.12 55
upstream ENSMUSE00000696461 Chr2:30170636..30170701 ATGTGAAGTCCTGGCAGACC Chr2:30170653..30170672 60.12 55
upstream ENSMUSE00000351620 Chr2:30172008..30172127 TCTGGTCTCGGGATCATTCT Chr2:30172017..30172036 59.61 50
upstream ENSMUSE00000696460 Chr2:30172008..30172127 TCTGGTCTCGGGATCATTCT Chr2:30172017..30172036 59.61 50
upstream ENSMUSE00000284715 Chr2:30172701..30172827 ATAAGCACAAGCCCCATGAT Chr2:30172744..30172763 59.42 45
upstream ENSMUSE00000696459 Chr2:30172701..30172827 ATAAGCACAAGCCCCATGAT Chr2:30172744..30172763 59.42 45
upstream ENSMUSE00000284709 Chr2:30177402..30177554 GTCAGACCAACCTTCGCATT Chr2:30177405..30177424 60.12 50
upstream ENSMUSE00000696458 Chr2:30177402..30177554 GTCAGACCAACCTTCGCATT Chr2:30177405..30177424 60.12 50
upstream ENSMUSE00000284700 Chr2:30177692..30177818 GCCCATCATTGATTTGGTTC Chr2:30177720..30177739 60.14 45
upstream ENSMUSE00000696457 Chr2:30177692..30177818 GCCCATCATTGATTTGGTTC Chr2:30177720..30177739 60.14 45
upstream ENSMUSE00000284690 Chr2:30178006..30178093 TCCCCTCCTGTAAACGTCAT Chr2:30178022..30178041 59.4 50
upstream ENSMUSE00000696456 Chr2:30178006..30178093 TCCCCTCCTGTAAACGTCAT Chr2:30178022..30178041 59.4 50
upstream ENSMUSE00000284683 Chr2:30178191..30178267 TGGACTGATCTTCGTCACACA Chr2:30178194..30178214 60.3 47.62
upstream ENSMUSE00000696453 Chr2:30178191..30178267 TGGACTGATCTTCGTCACACA Chr2:30178194..30178214 60.3 47.62
upstream ENSMUSE00000284675 Chr2:30179040..30179154 GGTATGGCAGCCTTCTGATG Chr2:30179063..30179082 60.62 55
upstream ENSMUSE00000696452 Chr2:30179040..30179154 GGTATGGCAGCCTTCTGATG Chr2:30179063..30179082 60.62 55
upstream ENSMUSE00000284665 Chr2:30180748..30180868 TACCACAAATGGCGCTACAA Chr2:30180823..30180842 60.13 45
upstream ENSMUSE00000696451 Chr2:30180748..30180868 TACCACAAATGGCGCTACAA Chr2:30180823..30180842 60.13 45
upstream ENSMUSE00000284656 Chr2:30180993..30181059 TGAACCTGTGCCAAGAGACA Chr2:30181026..30181045 60.44 50
upstream ENSMUSE00000696450 Chr2:30180993..30181059 TGAACCTGTGCCAAGAGACA Chr2:30181026..30181045 60.44 50
upstream ENSMUSE00000344490 Chr2:30181970..30182098 CCTGGCTTATACCGAAGCTG Chr2:30182006..30182025 59.86 55
upstream ENSMUSE00000696448 Chr2:30181970..30182098 CCTGGCTTATACCGAAGCTG Chr2:30182006..30182025 59.86 55
upstream ENSMUSE00000470054 Chr2:30182968..30183107 TCGGCTGAAACCTCCTTCTA Chr2:30183049..30183068 59.95 50
upstream ENSMUSE00000696446 Chr2:30182968..30183107 TCGGCTGAAACCTCCTTCTA Chr2:30183049..30183068 59.95 50
upstream ENSMUSE00000472889 Chr2:30184827..30184933 ACCTCATTGCTGTCCTAGCC Chr2:30184842..30184861 59.31 55
upstream ENSMUSE00000696445 Chr2:30184827..30184933 ACCTCATTGCTGTCCTAGCC Chr2:30184842..30184861 59.31 55
upstream ENSMUSE00000471957 Chr2:30186077..30186283 GACATGCGCATCAAAGTCAT Chr2:30186167..30186186 59.69 45
upstream ENSMUSE00000696444 Chr2:30186077..30186283 GACATGCGCATCAAAGTCAT Chr2:30186167..30186186 59.69 45
upstream ENSMUSE00000474783 Chr2:30186367..30186536 GGTGCTGGAGCTGATTGATT Chr2:30186402..30186421 60.23 50
upstream ENSMUSE00000696443 Chr2:30186367..30186536 GGTGCTGGAGCTGATTGATT Chr2:30186402..30186421 60.23 50
upstream ENSMUSE00000473792 Chr2:30187905..30187974 TCCGCTGTTTGGAACTCTCT Chr2:30187932..30187951 59.99 50
upstream ENSMUSE00000696441 Chr2:30187905..30187974 TCCGCTGTTTGGAACTCTCT Chr2:30187932..30187951 59.99 50
upstream ENSMUSE00000507307 Chr2:30188340..30188407 TGTGCCCTGATCATGAAGATA Chr2:30188358..30188378 59.09 42.86
upstream ENSMUSE00000696439 Chr2:30188340..30188407 TGTGCCCTGATCATGAAGATA Chr2:30188358..30188378 59.09 42.86
upstream ENSMUSE00000509991 Chr2:30188790..30188985 TGGCAGTTTACATGGCTGAC Chr2:30188879..30188898 59.72 50
upstream ENSMUSE00000696438 Chr2:30188790..30188985 TGGCAGTTTACATGGCTGAC Chr2:30188879..30188898 59.72 50
upstream ENSMUSE00000509070 Chr2:30191844..30191921 TTGATGGGACCAAAGCATTA Chr2:30191902..30191921 58.97 40
upstream ENSMUSE00000696437 Chr2:30191844..30191921 TTGATGGGACCAAAGCATTA Chr2:30191902..30191921 58.97 40
upstream ENSMUSE00000511818 Chr2:30192162..30192247 TGCTGCTTATCCTCCTACGC Chr2:30192217..30192236 60.51 55
upstream ENSMUSE00000696436 Chr2:30192162..30192247 TGCTGCTTATCCTCCTACGC Chr2:30192217..30192236 60.51 55
upstream ENSMUSE00000510877 Chr2:30192452..30192597 GCTGTGGAGAAAATCCTTGG Chr2:30192462..30192481 59.67 50
upstream ENSMUSE00000696435 Chr2:30192452..30192597 GCTGTGGAGAAAATCCTTGG Chr2:30192462..30192481 59.67 50

*** Putative Vector Insertion (Chr 2: 30192598 - 30192743) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000359163 Chr2:30192744..30192925 CTGTCTCCATGCTGTCCTTG Chr2:30192887..30192906 59.42 55
downstream ENSMUSE00000163634 Chr2:30195019..30195219 AGCTCCTTAGCCAGATGCAG Chr2:30195056..30195075 59.74 55
downstream ENSMUSE00000284610 Chr2:30195336..30195428 ACACTCAAGAGGGGCAAACA Chr2:30195400..30195419 60.69 50
downstream ENSMUSE00000284602 Chr2:30196109..30196267 GCCTCCGTCAGGAAATTGTA Chr2:30196230..30196249 60.07 50
downstream ENSMUSE00000284545 Chr2:30197212..30197349 ACGGTGTGATCTGCTTCCTC Chr2:30197276..30197295 60.27 55
downstream ENSMUSE00000284540 Chr2:30197893..30197967 ACAGGCCTGGCACAAGTAAC Chr2:30197925..30197944 60.18 55
downstream ENSMUSE00000410273 Chr2:30198053..30198310 AGACATCCGGAGTGAAGTGG Chr2:30198293..30198312 60.11 55
downstream ENSMUSE00000284529 Chr2:30198442..30198573 GGGAGCCACTTCAGAGTCAA Chr2:30198522..30198541 60.39 55
downstream ENSMUSE00000696434 Chr2:30198483..30198494 No primer for this exon
downstream ENSMUSE00000284523 Chr2:30198795..30198868 TAATGTTCGGGTCCCTTCTG Chr2:30198869..30198888 59.93 50
downstream ENSMUSE00000284519 Chr2:30198981..30199110 GCTTGGGAGATGAGCAGGTA Chr2:30199037..30199056 60.36 55
downstream ENSMUSE00000387211 Chr2:30199222..30199782 TGCACAAGTTGGATCAGAGG Chr2:30199373..30199392 59.83 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGTGCTTTAATCGCCTTGC Chr2:30192641..30192661 59.99 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTGCTTCGTGACTGGGAAA Chr2:30192642..30192662 60.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052533