Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20308
Trapped Gene
Lypla1 (ENSMUSG00000025903)
Vector Insertion
Chr 1: 4820397 - 4822391
Public Clones not available
Private Clones OST367666 (lexicon) OST289143 (lexicon) OST247003 (lexicon) OST219274 (lexicon)
OST216238 (lexicon) OST214770 (lexicon) OST188012 (lexicon)
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000154052 (Chr1:4820349..4820396 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000154052 (Chr1:4820349..4820396 +)
Downstram Exon
ENSMUSE00000154053 (Chr1:4822392..4822462 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGGGAATCTGGTGAAAGTCC Chr1:4822427..4822446 59.9 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000154051 Chr1:4797943..4798063 No primer for this exon
upstream ENSMUSE00000703291 Chr1:4797992..4798063 No primer for this exon
upstream ENSMUSE00000154054 Chr1:4798536..4798567 CCTTCACGGATTGGGAGATA Chr1:4798544..4798563 59.89 50
upstream ENSMUSE00000154050 Chr1:4818665..4818730 GCAGAAGCCTTTGCAGGTAT Chr1:4818675..4818694 59.48 50
upstream ENSMUSE00000154052 Chr1:4820349..4820396 No primer for this exon

*** Putative Vector Insertion (Chr 1: 4820397 - 4822391) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000154053 Chr1:4822392..4822462 TGGGAATCTGGTGAAAGTCC Chr1:4822427..4822446 59.9 50
downstream ENSMUSE00000154057 Chr1:4827082..4827155 No primer for this exon
downstream ENSMUSE00000154056 Chr1:4829468..4829569 GACACCAGCCAGTTTCTGCT Chr1:4829527..4829546 60.45 55
downstream ENSMUSE00000154049 Chr1:4831037..4831213 GGCACTGGAGAACGGAAATA Chr1:4831085..4831104 60.07 50
downstream ENSMUSE00000154055 Chr1:4835044..4836817 AAAAAGCCTGGTCTCCCAAT Chr1:4835679..4835698 59.94 45
downstream ENSMUSE00000703290 Chr1:4835044..4835433 CAATGAAGTGCTTGACATCCA Chr1:4835073..4835093 59.71 42.86

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCTTGTAGCCTTTGCAGGA Chr1:4820427..4820447 59.88 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCTTGTAGCCTTTGCAGGA Chr1:4820427..4820447 59.88 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025903