Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI20311
Trapped Gene
Egln2 (ENSMUSG00000058709)
Vector Insertion
Chr 7: 27944943 - 27945306
Public Clones not available
Private Clones OST367597 (lexicon) OST350500 (lexicon) OST326655 (lexicon) OST130844 (lexicon)
OST130758 (lexicon)
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000514070 (Chr7:27945307..27945426 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACGTGAGGCATGTTGACAAT Chr7:27945370..27945389 59.01 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000514070 (Chr7:27945307..27945426 -)
Downstram Exon
ENSMUSE00000473878 (Chr7:27944806..27944942 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACGTGAGGCATGTTGACAAT Chr7:27945370..27945389 59.01 45 AAATGAGCAACCGGTCAAAG Chr7:27944836..27944855 60.11 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000510361 Chr7:27951703..27951774 No primer for this exon
upstream ENSMUSE00000676552 Chr7:27951335..27951432 GTCTGGCAGGACCTCCCTTC Chr7:27951342..27951361 63.45 65
upstream ENSMUSE00000516047 Chr7:27949639..27950747 GACCAGATTGCCTGGGTAGA Chr7:27949751..27949770 60.07 55
upstream ENSMUSE00000711645 Chr7:27949639..27950747 GACCAGATTGCCTGGGTAGA Chr7:27949751..27949770 60.07 55
upstream ENSMUSE00000514070 Chr7:27945307..27945426 ACGTGAGGCATGTTGACAAT Chr7:27945370..27945389 59.01 45

*** Putative Vector Insertion (Chr 7: 27944943 - 27945306) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000473878 Chr7:27944806..27944942 AAATGAGCAACCGGTCAAAG Chr7:27944836..27944855 60.11 45
downstream ENSMUSE00000472068 Chr7:27944543..27944610 No primer for this exon
downstream ENSMUSE00000676551 Chr7:27944007..27944230 AACACCTTTCTGTCCCGATG Chr7:27944189..27944208 59.97 50
downstream ENSMUSE00000493349 Chr7:27943678..27944230 AACACCTTTCTGTCCCGATG Chr7:27944189..27944208 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAAGGTAGGGTTTGGGGTTG Chr7:27945289..27945309 58.81 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAAGGTAGGGTTTGGGGTTG Chr7:27945289..27945309 58.81 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058709